DNAzyme description

 Reaction  Reacting groups  Substrates Product  Metal ion Linkage  Seq description
Tyrosine azido‐adenylylation Group 1 - Tyrosine's hydroxyl

Group 2 - 2′‐Az‐dATP

L: DNA-anchored CQQPYITN octapeptide
R: 2′‐Az‐dATP
Azido-adenylated peptide Mn2+
Mg2+
Zn2+
phosphodiester N 40
 Buffer conditions
70 mm HEPES pH 7.5, 1 mm ZnCl2, 20 mm MnCl2, 40 mm MgCl2, 150 mm NaCl
 Yield (%) kcat/ kobs
61 kobs = 0.24 h-1
 Catalytic region of the DNAzyme
GCATACTGTTAGGGCTACAGATATACGTATATCTGCGCTA
Notes
Natural ATP is generally tolerated well in place of 2′‐Az‐dATP.

 Reported in...

Year of Publication First Author Laboratory Title PubMed ID DOI Reaction
2016 P Wang S K Silverman DNA-Catalyzed Introduction of Azide at Tyrosine for Peptide Modification. 27391404 10.1002/anie.201604364 Tyrosine azido‐adenylylation

Copyright © Genesilico - All rights reserved
This website is free, open to all users and there is no login required.
If you have any advice or suggestions for corrections or improvements, please contact: Almudena Ponce Salvatierra