| Reaction | Reacting groups | Substrates | Product | Metal ion | Linkage | Seq description | RNA cleavage |
Group 1 - 2'-OH of rU Group 2 - vicinal phosphate |
S: cleavage in cis |
cleavage after either position 2 or 6 in the all-RNA substrate, both being UA junctions. |
M2+-independent |
RNA phosphodiester | N 50 |
|---|
| Buffer conditions |
|---|
| 0.2 M NaCl, 10 mM EDTA, 50 mM Tris–HCl pH 7.5 |
| kcat/ kobs |
|---|
| kobs = 0.07 min-1 |
| Catalytic region of the DNAzyme |
|---|
| CCATTCTCCTCTGCTGGACTATTCGGGTCTTTGTTCTCTCATGGTTGTGT |
| Notes |
|---|
| C5-imidazolyl-modified dUTP and 3-(aminopropynyl)-7-deaza-dATP were used during the selection, incorporating in this way two protein-like functionalities, namely, imidazolyl (histidine analogue) and primary amino (lysine analogue) into the DNAzymes. |
| Year of Publication | First Author | Laboratory | Title | PubMed ID | DOI | Reaction |
|---|---|---|---|---|---|---|
| 2004 | A V Sidorov | D M Williams | Sequence-specific cleavage of RNA in the absence of divalent metal ions by a DNAzyme incorporating imidazolyl and amino functionalities. | 15004246 | 10.1093/nar/gkh326 | RNA cleavage |