Published on 2004 in Nucleic Acids Res. volume 32 issue 4.

PubMed ID: 15004246

DOI:10.1093/nar/gkh326

Abstract:

Two modified 2′‐deoxynucleoside 5′‐triphosphates have been used for the in vitro selection of a modified deoxyribozyme (DNAzyme) capable of the sequence‐specific cleavage of a 12 nt RNA target in the absence of divalent metal ions. The modified nucleotides, a C5‐imidazolyl‐modified dUTP and 3‐(aminopropynyl)‐7‐deaza‐dATP were used in place of TTP and dATP during the selection and incorporate two extra protein‐like functionalities, namely, imidazolyl (histidine analogue) and primary amino (lysine analogue) into the DNAzyme. The functional groups are analogous to the catalytic Lys and His residues employed during the metal‐independent cleavage of RNA by the protein enzyme RNaseA. The DNAzyme requires no divalent metal ions or other cofactors for catalysis, remains active at physiological pH and ionic strength and can recognize and cleave a 12 nt RNA substrate with sequence specificity. This is the first example of a functionalized, metal‐independent DNAzyme that recognizes and cleaves an all‐RNA target in a sequence‐specific manner. The selected DNAzyme is two orders of magnitude more efficient in its cleavage of RNA than an unmodified DNAzyme in the absence of metal ions and represents a rate enhancement of 105 compared with the uncatalysed hydrolysis of RNA.



DNAzymes linked to this article:

Name Isolated sequence Length Reaction
clone 32 CCATTCTCCTCTGCTGGACTATTCGGGTCTTTGTTCTCTCATGGTTGTGT      50 RNA cleavage
Copyright © Genesilico - All rights reserved
This website is free, open to all users and there is no login required.
If you have any advice or suggestions for corrections or improvements, please contact: Almudena Ponce Salvatierra