| Reaction | Reacting groups | Substrates | Product | Metal ion | Linkage | Seq description | RNA cleavage |
Group 1 - 2'-OH of rA Group 2 - vicinal phosphate |
X: Fluorescein (F)- and a DABCYL (Q)-modified deoxyribothymidine. S: cleavage in cis |
specific cleavage at desired position |
CEM E. coli |
RNA phosphodiester | N 70 |
|---|
| Catalytic region of the DNAzyme |
|---|
| CACGGATCCTGACAAGGATGTGTGCGTTGTCGAGACCTGCGACCGGAACACTACACTGTGTGGGATGGATTTCTTTACAGTTGTGTGCAGCTCCGTCCGACTCTTCCTAGCFRQGGTTCGATCAAGA |
| Notes |
|---|
| The DNAzyme catalyzes the cleavage ligation solely in the presence of crude extracellular mixture of Escherichia coli. It is a flourogenic probe for the detection of this bacterium. |
| Year of Publication | First Author | Laboratory | Title | PubMed ID | DOI | Reaction |
|---|---|---|---|---|---|---|
| 2011 | M M Ali | Y Li | Fluorogenic DNAzyme probes as bacterial indicators. | 21412961 | 10.1002/anie.201100477 | RNA cleavage |