DNAzyme description

 Reaction  Substrates Product  Seq description
Porphyrin metalation S: mesoporphyrin IX (MPIX)
Cu-MPIX N 40
 Buffer conditions
25 mM TrisOAc pH 7.5, 25 mM KCl, 0.5% (w/v) Triton X-100, 1% (v/v) DMSO
 Catalytic region of the DNAzyme
AAAAGAATGCTCATCCTGGGGTAGGCATGAAGCGGGGCCG
Notes
The in vitro selection was conducted to isolate aptamers binding N-methyl mesoporphyrin IX (NMM). The reported buffer in this case is not the one used during the selection procedure, but instead, the one used to evaluate catalytic activity of the selected aptamers.

 Reported in...

Year of Publication First Author Laboratory Title PubMed ID DOI Reaction
2013 J Yang M T Bowser Capillary electrophoresis-SELEX selection of catalytic DNA aptamers for a small-molecule porphyrin target. 23234289 10.1021/ac302721j Porphyrin metalation

Copyright © Genesilico - All rights reserved
This website is free, open to all users and there is no login required.
If you have any advice or suggestions for corrections or improvements, please contact: Almudena Ponce Salvatierra