Published on 2017 in J. Am. Chem. Soc. volume 139 issue 1.

PubMed ID: 27935689

DOI:10.1021/jacs.6b10274

Abstract:

We describe an unprecedented DNA-catalyzed DNA cleavage process in which a radical-based reaction pathway cleanly results in excision of most atoms of a specific guanosine nucleoside. Two new deoxyribozymes (DNA enzymes) were identified by in vitro selection from N40 or N100 random pools initially seeking amide bond hydrolysis, although they both cleave simple single-stranded DNA oligonucleotides. Each deoxyribozyme generates both superoxide (O2–• or HOO•) and hydrogen peroxide (H2O2) and leads to the same set of products (3′-phosphoglycolate, 5′-phosphate, and base propenal) as formed by the natural product bleomycin, with product assignments by mass spectrometry and colorimetric assay. We infer the same mechanistic pathway, involving formation of the C4′ radical of the guanosine nucleoside that is subsequently excised. Consistent with a radical pathway, glutathione fully suppresses catalysis. Conversely, adding either superoxide or H2O2 from the outset strongly enhances catalysis. The mechanism of generation and involvement of superoxide and H2O2 by the deoxyribozymes is not yet defined. The deoxyribozymes do not require redox-active metal ions and function with a combination of Zn2+ and Mg2+, although including Mn2+ increases the activity, and Mn2+ alone also supports catalysis. In contrast to all of these observations, unrelated DNA-catalyzed radical DNA cleavage reactions require redox-active metals and lead to mixtures of products. This study reports an intriguing example of a well-defined, DNA-catalyzed, radical reaction process that cleaves single-stranded DNA and requires only redox-inactive metal ions.



DNAzymes linked to this article:

Name Isolated sequence Length Reaction
RadDz6 TAAGATAAACACACCGGCCGTCACGCTGCCTCAGACGGTGAGTGACCCTAAAATAAGGGGATAACCCAAGGCCGATATCCCAATTTGAGATGGTCGGGGA      100 DNA cleavage
RadDz3 TAAGGGAGGTACGATACACGCCACTTGCACGTTGTGGCGA      40 DNA cleavage
Copyright © Genesilico - All rights reserved
This website is free, open to all users and there is no login required.
If you have any advice or suggestions for corrections or improvements, please contact: Almudena Ponce Salvatierra