Published on 2015 in ChemBioChem volume 17 issue 2.

DOI:10.1002/cbic.201500603

Abstract:

Enzymes working in organic solvents are important for analytical chemistry, catalysis, and mechanistic studies. Although a few protein enzymes are highly active in organic solvents, little is known regarding nucleic acid‐based enzymes. Herein, we report the first RNA‐cleaving DNAzyme, named EtNa, that works optimally in concentrated organic solvents containing only monovalent Na+. The EtNa DNAzyme has a rate of 2.0 h−1 in 54 % ethanol (with 120 mm NaCl and no divalent metal ions), and a Kd of 21 mm Na+. It retains activity even in 72 % ethanol as well as in DMSO. With 4 mm Na+, the rate in 54 % ethanol is >1000‐fold higher than that in water. We also demonstrated the use of EtNa to measuring the ethanol content in alcoholic drinks. In total, this DNAzyme has three unique features: divalent metal independent activity, Na+ selectivity among monovalent metals, and acceleration by organic solvents.



DNAzymes linked to this article:

Name Isolated sequence Length Reaction
EtNa TTTCGCCATCTTTTCTCACACCGTACTCGGTAAGGTTGTTAGTGACTCGTGAC      53 RNA cleavage
Copyright © Genesilico - All rights reserved
This website is free, open to all users and there is no login required.
If you have any advice or suggestions for corrections or improvements, please contact: Almudena Ponce Salvatierra