Published on 2002 in Comb. Chem. High Throughput Screen. volume 5 issue 4.

PubMed ID: 12052183

DOI:10.2174/1386207023330264

Abstract:

Metal ions play important roles in both the structure and function of catalytic DNA and RNA. While most natural catalytic RNA molecules (ribozymes) are active in solutions containing Mg2+, in vitro selection makes it possible to search for new catalytic DNA/RNA that are specific for other metal ions. However, previous studies have indicated that the in vitro selection protocols often resulted in catalytic DNA/RNA that were equally active or sometimes even more active with metal ions other than the metal ion of choice. To improve the metal ion specificity during the in vitro selection process, we implemented a negative selection strategy where the nucleic acid pool was subjected to a solution containing competing metal ions. As a result, those nucleic acids that were active with those metal ions are discarded. To demonstrate the effectiveness of the negative selection strategy, we carried out two parallel in vitro selections of Co2+- dependent catalytic DNA. When no negative selection was used in the selection process, the resulting catalytic DNA molecules were more active in solutions of Zn2+ and Pb2+ than in Co2+. On the other hand, when the negative selection steps were inserted between the normal positive selection steps, the resulting catalytic DNA molecules were much more active with Co2+ than in other metal ions including Zn2+ and Pb2+. These results suggest strongly that in vitro selection can be used to obtain highly active and specific transition metal iondependent catalytic DNA/RNA, which hold great promise as versatile and efficient endonucleases as well as sensitive and selective metal ion sensors.



DNAzymes linked to this article:

Name Isolated sequence Length Reaction
clone11 TTGTATTAGCTACACTGTTAGTGCATCGTTTTTAATCTCG      40 RNA cleavage
clone18 TTGTATTAGCTACACTGTTAGTGGATCGGGTCTAATCTCG      40 RNA cleavage
Copyright © Genesilico - All rights reserved
This website is free, open to all users and there is no login required.
If you have any advice or suggestions for corrections or improvements, please contact: Almudena Ponce Salvatierra