Published on 2010 in J. Mol. Biol. volume 400 issue 4.

PubMed ID: 20630470

DOI:10.1016/j.jmb.2010.05.047

Abstract:

Several RNA-cleaving deoxyribozymes (DNAzymes) have been reported for efficient cleavage of purine-containing junctions, but none is able to efficiently cleave pyrimidine-pyrimidine (Pyr-Pyr) junctions. We hypothesize that a stronger Pyr-Pyr cleavage activity requires larger DNAzymes with complex structures that are difficult to isolate directly from a DNA library; one possible way to obtain such DNAzymes is to optimize DNA sequences with weak activities. To test this, we carried out an in vitro selection study to derive DNAzymes capable of cleaving an rC-T junction in a chimeric DNA/RNA substrate from DNA libraries constructed through chemical mutagenesis of five previous DNAzymes with a k(obs) of approximately 0.001 min-1 for the rC-T junction. After several rounds of selective amplification, DNAzyme descendants with a k(obs) of approximately 0.1 min-1 were obtained from a DNAzyme pool. The most efficient motif, denoted "CT10-3.29," was found to have a catalytic core of approximately 50 nt, larger than other known RNA-cleaving DNAzymes, and its secondary structure contains five short duplexes confined by a four-way junction. Several variants of CT10-3.29 exhibit a k(obs) of 0.3-1.4 min-1 against the rC-T junction. CT10-3.29 also shows strong activity (k(obs)>0.1 min-1) for rU-A and rU-T junctions, medium activity (>0.01 min-1) for rC-A and rA-T junctions, and weak activity (>0.001 min-1) for rA-A, rG-T, and rG-A junctions. Interestingly, a single-point mutation within the catalytic core of CT10-3.29 altered the pattern of junction specificity with a significantly decreased ability to cleave rC-T and rC-A junctions and a substantially increased ability to cleave rA-A, rA-T, rG-A, rG-T, rU-A, and rU-T junctions. This observation illustrates the intricacy and plasticity of this RNA-cleaving DNAzyme in dinucleotide junction selectivity. The current study shows that it is feasible to derive efficient DNAzymes for a difficult chemical task and reveals that DNAzymes require more complex structural solutions for such a task.



DNAzymes linked to this article:

Name Isolated sequence Length Reaction
CT10-3.29T CAAATTGATCGGTGGGGAGCAACTGAAAGGCGGTTGCAATGCGGATGGATGGTACGGTC      59 RNA cleavage
Copyright © Genesilico - All rights reserved
This website is free, open to all users and there is no login required.
If you have any advice or suggestions for corrections or improvements, please contact: Almudena Ponce Salvatierra