Published on 2011 in Biochemistry volume 50 issue 21.

PubMed ID: 21510668

DOI:10.1021/bi200585n

Abstract:

This study focuses on the development of DNA catalysts (deoxyribozymes) that modify side chains of peptide substrates, with the long-term goal of achieving DNA-catalyzed covalent protein modification. We recently described several deoxyribozymes that modify tyrosine (Tyr) or serine (Ser) side chains by catalyzing their reaction with 5′-triphosphorylated RNA, forming nucleopeptide linkages. In each previous case, the side chain was presented in a highly preorganized three-dimensional architecture such that the resulting deoxyribozymes inherently cannot function with free peptides or proteins, which do not maintain the preorganization. Here we describe in vitro selection of deoxyribozymes that catalyze Tyr side chain modification of tethered and free peptide substrates, where the approach can potentially be generalized for catalysis involving large proteins. Several new deoxyribozymes for Tyr modification (and several for Ser modification as well) were identified; progressively better catalytic activity was observed as the selection design was strategically changed. The best new deoxyribozyme, 15MZ36, catalyzes covalent Tyr modification of a free tripeptide substrate with a kobs of 0.50 h–1 (t1/2 of 83 min) and up to 65% yield. These findings represent an important advance by demonstrating, for the first time, DNA catalysis involving free peptide substrates. The new results suggest the feasibility of DNA-catalyzed covalent modification of side chains of large protein substrates and provide key insights into how to achieve this goal.



DNAzymes linked to this article:

Name Isolated sequence Length Reaction
15MZ36 CAAGGAGAGTTGTACAAGCTCGGGTCGTGTTCAAAGGGATC      41 Covalent Modification of Amino Acid Side Chains
10KC3 CAAGGAGCGTTGGACAAGCGCGGGTCGTTCCAAAAGTAGG      40 Covalent Modification of Amino Acid Side Chains
9NG14 CAAGGAGTGCTGGAGAGGCACGGGTCGTGGCAAAAGTGTC      40 Covalent Modification of Amino Acid Side Chains
9NG2 CAAGGAGTGATCGTCGATCATGGGTCGTTCTGAAAGGCAG      40 Covalent Modification of Amino Acid Side Chains
9NG3 CAAGGAGCGATGAACAAGCGCGGGTCGTTCCGAAAGCTGG      40 Covalent Modification of Amino Acid Side Chains
9NG5 CAAGGAGAGTGGGAAAAGCTCGGGTCGTTCTCAAAGGGAG      40 Covalent Modification of Amino Acid Side Chains
9NG6 CAAGGAACGTTGCACAAACGTGGGTCGTGGCCAAAAGGTC      40 Covalent Modification of Amino Acid Side Chains
9NG15 CAAGGAGCGGTGGCCTACCGTGGGTCGTGTTCAAACGGATC      41 Covalent Modification of Amino Acid Side Chains
11MN5 CAAGGAGGCACCTCGATAAGTGCCGGGTCGTTCCGAAAGCTGG      43 Covalent Modification of Amino Acid Side Chains
11MN10 CAAGGAGCGAAGGTCAAGAGCGGGTCGTGGCAAAAGTGCA      40 Covalent Modification of Amino Acid Side Chains
11MN19 CAAGGAGAGGTTGAGAATCTCGGGTCGTTTCCAAAGGGGA      40 Covalent Modification of Amino Acid Side Chains
15MZ30 CAAGGAGCCCGGGACTAGGGCGGGTCGTGGCAAAAGTGTC      40 Covalent Modification of Amino Acid Side Chains
15MZ49 CAAGGAGTGTTGGATAAACGCGGGTCGTGTTCAAAGGGATC      41 Covalent Modification of Amino Acid Side Chains
6QG6 CAAGGAGACTTGTATAAAGTCGGGTCGTCTTCAAAGGGATG      41 Covalent Modification of Amino Acid Side Chains
6QG18 CAAGGAGGGTTGTAGCAGCCCGGGTCGTGTTGAAAGGCATC      41 Covalent Modification of Amino Acid Side Chains
15NZ11 CAAGGAGCGTGGGACAAGAGCGGGTCGTGTTCAAAGGGATC      41 Covalent Modification of Amino Acid Side Chains
15NZ16 CAAGGAGCGATAGTCATACGCGGGTCGTGGCAAAAGTGTC      40 Covalent Modification of Amino Acid Side Chains
Copyright © Genesilico - All rights reserved
This website is free, open to all users and there is no login required.
If you have any advice or suggestions for corrections or improvements, please contact: Almudena Ponce Salvatierra