Search for ligation


DNAzymes

Name Length Enzyme region of the deoxyribozyme Reaction Metal Ions/cofactors
8LX12 50 CCCCGAGGTGTGGACATAGCGGGCTGGTGTGGCGCGCAGTGAGCCTAGTG RNA ligation Mn2+ 
8LX13 50 CATCGGTGTAGCGATGCACGGGCAAAGATACATTCGCAGTGAGGGTGCGG RNA ligation Mn2+ 
8LX14 50 CCACGTGCGAGGTTAGACGTCAGTGGCTGGTGTTCGCAGTGAGCCTATTG RNA ligation Mn2+ 
8LX15 49 CCGACGCGTCCAGGAGGCAAGGGCTATATGCACCGCAGTGAGGGCTCGG RNA ligation Mn2+ 
8LX16 50 CACGAGGTAGGGAGGGGCACACTGCTATGCTCAGCGCAGTGAGAGTATGC RNA ligation Mn2+ 
8LX17 48 CACATGTCTAGCGGCGTGCGGGAGAAGTGCAAGCGCTGTGAGGGTGTG RNA ligation Mn2+ 
8LX18 50 CCAAGGCAGAGCGTAGCCAGACAGCCGGGAGGTTCGCAGTGAGTGAATGG RNA ligation Mn2+ 
8LX21 50 GTAGCCACATTAGTGCGCTGCAACTGCTATGCAACGCAGTGAGAGGGTGC RNA ligation Mn2+ 
8LV1 50 GCCGGTGGAAGGTTCTCTGCCAAAAGTGGTCGTCCGCAGTGAGACTTTAG DNA ligation Mn2+ 
8LV3 51 CCATGGACGTATGGTTTGGTATGCCGAACGCGGACGCAGGTGAGGCAGGG... DNA ligation Mn2+ 
8LV7 50 CAGGGTGAGAGGACCGTAAGTGTTAGTTGACACACGCAGTGAGCTTCGAT DNA ligation Mn2+ 
8LV9 50 GTCGGGCGTGTGGTTGCAAAGGACGTCTGGAGTGCGCAGTGAGACCGCCA DNA ligation Mn2+ 
8LV11 49 CCTAGGGAATGCGGAGGCTTGAGGTGTGTCTTGGCGCAGGAGCGTAACC DNA ligation Mn2+ 
8LV12 50 CAGTAGACGCCGCATAGGGCACTGTTTACTGCTCCGAAGTGAGAGGAGGG DNA ligation Mn2+ 
8LV13 49 CGAGAGCGTGAATGTTGGTTGAGACACAGTGTACGCAGTGAGAGGGAAC DNA ligation Mn2+ 
8LV15 50 CAGGGAGAGAGGCGTACGCGGAGATATACGCGGTCGCAGTGAGATTCGAT DNA ligation Mn2+ 
8LV17 50 CACGAGTAAGTGCTCGATTGGGTTACACTGAGGCCGCAGTGAGCAAGGAG DNA ligation Mn2+ 
8LV21 49 CAGGGTGAGAGGACGAAAGCATGGGGTTAGCTGCGCAGTGAGATTCGAT DNA ligation Mn2+ 
8LV22 50 CAGGGTGAAGTGGAAGCTACATTGTATGATTGCGCGCAGTGAGTTTCGAG DNA ligation Mn2+ 
10-13 58 CTAACCACTATCCATGATTGTAAGAGCGGACAGCTGCAACGGGTTGATTA... RNA ligation Mg2+ 
10-9 57 CTAACCATTATCCTCGATTGTTAGAACGAACAGTTGCAACGGGTTGATTA... RNA ligation Mg2+ 
10-19 56 TAACCCATTATCTTCGATGTTAGAACGAACAGCTGCAACGGGTTGATTAT... RNA ligation Mg2+ 
10-15 57 CTCGCCATTATCCTTGAGTGTTAGAACGAACAGTTGCAACGGGTTGATTA... RNA ligation Mg2+ 
10-7 57 CTATGCATTATCCTTGACTGTTAGATCGAGCAGTTGCAACGGGTTGATTA... RNA ligation Mg2+ 
10-22 57 CTAACCATTATCCCTGATTGTTAGAACGAACAGTTGCGACGGGTTGATTA... RNA ligation Mg2+ 
10-6 57 CTACGCATTATCCCTGGTTGTTAGAACGAGCAGTTGCAACGGGTTGATTA... RNA ligation Mg2+ 
10-21 58 CAAACCATTATCCTCGATTGCAAGAACGAGCAGTTGGAACGGGTTGATTG... RNA ligation Mg2+ 
10-3 58 CATATTCATCATCCTCGACTGCAAGAAAGAACAGTTGGAACGGGTTGAAT... RNA ligation Mg2+ 
6CA4 40 CACGTGGACTTGGCATGGTCCCAGCGCTAGTTTTAAGCGC RNA ligation Mn2+ 
6CA6 40 CCCGTACACGACTGTGGTGTTGAACGGCTGCTAGCCGGCA RNA ligation Mn2+ 
8LX8 49 CCGACGAGGTGAGGGGCATGCGGTACACGCGCATATAGTGAGGGGTCCA RNA ligation Mn2+ 
6CA15 40 CCCGTGACATTCATATGGGGTCGGTTCCAATCGCGAATTA RNA ligation Mn2+ 
6CA16 40 CCCGTACACTCGACGTGGTGACGCTGTGGCGTGAGCCTGT RNA ligation Mn2+ 
6CA18 41 CAGAGATGGGGTGTGATCTGGGTTGATAACACGGAGCGGTC RNA ligation Mn2+ 
6CA21 41 CCCGTACACTTAGAATGGTGCAGCCAGCATGCTGTACAGTA RNA ligation Mn2+ 
6CA23 40 CCCGTGCACTCTATGATGGTGTCCCCTGATACCAACAGGG RNA ligation Mn2+ 
6CA27 40 CACGTGACCTCAGGAATGGGTTCGAGGTGGGTGCACCTGC RNA ligation Mn2+ 
9BX1 40 GGAACGCAGTCGCACGTGACTAGGGAATCGTATCCTCATG RNA ligation Mn2+ 
9BX3 40 CGTGGTTTCCGGAATGCCTAGCGTTCAAGTGTGGATGCTT RNA ligation Mn2+ 
9BX4 40 CCGCGAGGCCGTGGCCCGAGTTGGTCAAAGCACAACGAGT RNA ligation Mn2+ 
9BX10 40 GATGTGGTCCAGCTGATAGGGCAGCGTTAGGCATACGTTG RNA ligation Mn2+ 
9BX15 40 GCGACGGATTTAGGTGTGTTAGACAGGGTCGGGAATAGAT RNA ligation Mn2+ 
9BX16 39 GCAGCGGGGAAGGCACTTCCAGGCAGGGGGGAAAAACAA RNA ligation Mn2+ 
6BX6 40 CGAGGCGTAGGTTAATTACAAACGGCTCAGACAACGTATG RNA ligation Mn2+ 
6BX35 40 GGCGAAGGGACTACGTTGGCCATGCGGGTGGGCCGCTATG RNA ligation Mn2+ 
6BX39 40 GAACGTGAGGTGCGGGAATTAATCACAAACCGGAAACGGA RNA ligation Mn2+ 
6BX43 40 CACCACAATGGTTGATGCCGGGCCAAGTGGCGCAGCATAC RNA ligation Mn2+ 
6BX45 40 CGCACGGAGCCCGTTAGGGGTCCACGGAGTGGGTGAACCT RNA ligation Mn2+ 
6BX47 40 CCGGGCATCAAGTGCGCAACGATGACGAAATCGGGTGGGT RNA ligation Mn2+ 
6BX20 40 CGCACGGTCTGGTGTGGAAGCCAGGTTGCCTCCCTGCAAA RNA ligation Mn2+ 
6BX22 40 CAGGGGGAGCGAGCACTAATACAAGCGGGTAGGAGGCCCT RNA ligation Mn2+ 
6BX23 40 CGGGAGGAGGCAAAGGCTAGTTTGTCGGATAGGAGGCCCT RNA ligation Mn2+ 
6BX34 40 CGTGGGAGCCATTGGGAGGGGCTGAGAACATAAGTCACGA RNA ligation Mn2+ 
6BX8 40 GCAGTGCAAATGAGGCATGGAGAAACTACTCTATGCTGAA RNA ligation Mn2+ 
6BX16 40 GCAGTGCAAATGAGTAAGGACTGATATCAGTCACTACGAA RNA ligation Mn2+ 
6BX40 40 GCAGTGCTAATGAGGGTGTGGCAGAAGCTATACAGCCGAA RNA ligation Mn2+ 
6BX19 40 GACGGGTGGGGAAATCAGCCTGTATTGGGTTCAGAGCGGA RNA ligation Mn2+ 
6BX21 40 GACGACAGCGGTTCCCAGCTCAGTAGTGATAGTTTACTGC RNA ligation Mn2+ 
6BX26 40 GACACCGAGCAGAGGACCGGACCTAGTTGGTAAAAGGTAA RNA ligation Mn2+ 
6CA17 40 CACAGGCGCGCGAGGGGCTATGTCCGGTGGTGCAGGCGGA RNA ligation Mn2+ 
6CA28 40 CGGAAGGATGACAAGGAGCGTAGCTGATGGGGACTCAGAC RNA ligation Mn2+ 
6CA2 40 GGGGCGTAGTGGAGACCGGGGACAGTGGAGTACGTCCAGC RNA ligation Mn2+ 
6CA20 40 GTTAACGCAGGGCGTCGTACTACATCCTTGTGCAGCTACG RNA ligation Mn2+ 
6CA1 41 TGAAGCGCGTTATCCATGCAAAAAATGGATCCGGTACCAAC RNA ligation Mn2+ 
6CA5 40 TGCAGCGGCTGCGCGGGTATCCGGTCTCCAGGGGACGCTT RNA ligation Mn2+ 
6CA7 40 AGACCCAGTGTTCTCAGCCGCCCGCCGCAGCGGGGAGGTA RNA ligation Mn2+ 
6CA14 40 CGAAGACGAGGAGTAACCTTAGATGAAGGTGGGGACGATT RNA ligation Mn2+ 
6CA24 40 GGGCGAGGACCGGGTACTAGGGGAACACGCCGCACGCGGG RNA ligation Mn2+ 
6CA25 40 AGACGCAGTGTCAGGGTACCACAGACATGTGGAGTGGCTG RNA ligation Mn2+ 
9BX11 40 CATGCGTGTTGCGTGGATACGAGGCTATTCAGAGGGTAAA RNA ligation Mn2+ 
6CA10 40 CACGTACACTTGGTATGGTGTGACACCTCAGCTCATACAT RNA ligation Mn2+ 
7Q10 20 TTACGTGGAGGTGGGCTCTA RNA ligation Mg2+ 
7Z81 38 ACGGCGAGTTTCATGGAGTGATTGGGAGGTTAGCTCTA RNA ligation Mg2+ 
12BB27 40 CCGCTCCGATTGGTGAAGTCTATTGGGGCCTGTAGGCGAG RNA ligation Zn2+ 
7Z101 40 CCCGAGGAGGGGCGGGGGGACTTGGTGTGGAGTTTCATTC RNA ligation Mg2+ 
9A5 40 AAGGGGAGGGCCGATTGGCATTATCGGCGTCTTAGCTCTA RNA ligation Mg2+ 
9A6 39 TAACCGTGGTTACCGTAAGCGCGGGGCTTATAGGGGATT RNA ligation Mg2+ 
9DB1* 31 GGATCATACGGTCGGAGGGGTTTGCCGTTTA RNA ligation Mn2+ Mg2+ 
9F21 40 AATGATGCTTGACAGGGTCTATAGTTTCTATGTAGCCCGA RNA ligation Mn2+ Mg2+ 
9F13 38 AGGATGTGGGGTTTTGCCCGAGGGTATGGCAGTGGGGA RNA ligation Mn2+ Mg2+ 
7CX2 40 GTGAGAGCCATTGTGCATTGTGGTGCAACTGTACGCGCCT RNA ligation Zn2+ 
7CX3 40 GTGAGAGCAGGTTTGGCACGCGTGCCACTAACCCGCGCCT RNA ligation Zn2+ 
7CX4 40 GTGGGAGCCTGATGGAAGAATGGGAGAACAGCACGCGCCT RNA ligation Zn2+ 
7CX5 40 GGGAGAGCTAGGAGGCGCTGAGTCTCGGCTCCTCGCGCCT RNA ligation Zn2+ 
7CX6 40 GTGAGAGCAAGCGAGGGATACATGAACCGAAACCGCGCCT RNA ligation Zn2+ 
7CX7 40 GTGAGAGCAGTAAACGGAAGGCCTCTTCCTGTCCGCGCCT RNA ligation Zn2+ 
7CX8 40 GTGAGAGCATGTGGCACCCTGGCAGGAACCTAACGCGCCT RNA ligation Zn2+ 
7CX9 40 ACTGAGAGCCTCGATGAATGCCTAATTATATCGTCGCGCC RNA ligation Zn2+ 
7CX10 40 GTGAGAGCAATACGTATGAAGATATTGAAGTTTCGCGCCT RNA ligation Zn2+ 
7CX12 40 GTGAGAGCATCACTGTAACCGCCGTGCGGTGGACGCGCCT RNA ligation Zn2+ 
7CX13 39 GGGAGAGCAGTTATGATGCATGAGCCATTGACCGCGCCT RNA ligation Zn2+ 
7CX14 40 GGGAGAGCAGCGATGCAAGACATTGGGGCGGAGCCGCGCT RNA ligation Zn2+ 
7CX21 39 TGAGAGCATTTCCGGCGGAGCTCTACGGGGGCCGCGCCT RNA ligation Zn2+ 
7CX11 40 TTTAGTCAGGAGTAGACATCGATGATTGCTAATCGAACCT RNA ligation Zn2+ 
8CW1 40 GTGAGAGAACCGCGGTGTAGACACAGATCGCGGCGCGCCT RNA ligation Zn2+ 
8CW11 39 GGGAGAGCAGTTATGACGCATAAGCTATTGACCGCGCCT RNA ligation Zn2+ 
8CW15 40 GTGAGAGCAATCACTTTGGGTAGGTACGGGTGAACGCGCT RNA ligation Zn2+ 
8CW16 40 GTTAGAGCCAAACACGTTTGTGTCAGCGGGTTTCGCGCCT RNA ligation Zn2+ 
8CW20 40 GGAAGAGCAATGTACTCCGACGTCAGAGGATATCGCGCCT RNA ligation Zn2+ 
8CW3 40 ACGCCCACCATTTAAGAGCATCGCCGGAATAGCGGGGACT RNA ligation Zn2+ 
12BB26 40 ACTATACCACCGAGATTCGAATTGGAGCAGTAGTGGCTTG RNA ligation Zn2+ 
12BB36 40 ACCGGTCCCTGTCGGTCGAAGGAGTGGCACTGAGGAGAAT RNA ligation Zn2+ 
8CW4 40 GCACGGCCGGATTGGGGGGCCCAATGACTTGATCATTGCT RNA ligation Zn2+ 
12BB41 40 ACGCGAGGGGAGTTCAATCGCTTGTTCGGCAAGGTCGGGA RNA ligation Zn2+ 
8CW9 40 ACACGCGTTACGGACTGAGCAGATTCAGGCCAAACTGCCT RNA ligation Zn2+ 
9F7 40 AATGAGGCTTGGCAGGGATTTAGTATTTTAACACTCCCGG RNA ligation Mn2+ Mg2+ 
12BB2 40 ACCGCGGGAGCTACGTTAGTGGTAACTGCTTGTAGGCGAG RNA ligation Zn2+ 
8CW12 39 ACATGTGCGGTAATGAGGCGTAGACAAATAGAGATACCT RNA ligation Zn2+ 
12BB21 41 AAGGCAGCAGGCGGCATTTTTTGTCCGTACGTTCTCCTATA RNA ligation Zn2+ 
12BB22 40 ACCGCGGGAGTTTCGTTAGTGGTGACTGCTTGTAGGCGAG RNA ligation Zn2+ 
12BB25 40 GTAGAGTGGTTCCGGTTATCGCCTTAGATACCATTGCTGT RNA ligation Zn2+ 
8CW14 40 GCGGGGTTAAGCCACGAATGCGGGGCAAAGCGTACCCCCT RNA ligation Zn2+ 
12BB38 40 CCGCTGCGGAGGTTGTACGCGTCTGTGGCTTGTAGGCGAG RNA ligation Zn2+ 
12BB6 40 TACACCTATTATGGTTTCGTGAGGGGTGTGGCTGGTGCTG RNA ligation Zn2+ 
12BB12 40 CAGAGCCCCTTACGTACAGCCTTTTTAGGTAACCGGGGAG RNA ligation Zn2+ 
12BB24 40 CAGCGCGATTGGGGGCGTGATTGAAGCTCGGGGTTGGTTA RNA ligation Zn2+ 
12BB23 40 TACACCTATAATGGTTTCGTGAGGGGTGTGGCTGATGCTG RNA ligation Zn2+ 
12BB30 40 CCTGTACTGCGCTGCTCAAATCAGCCGGGTGTGTGAACTC RNA ligation Zn2+ 
12BB32 40 TGTATGTGGGGGGTGTGTATCAGTCTACTGTGGCTTAAGC RNA ligation Zn2+ 
6J12 40 AGGGAGCGGTGTGGCACAGACAGGGTATTAACTCTGTGAG RNA ligation Zn2+ 
6J1 40 GTGGGAGGACGCGTCAGTAGTTATGACCTGCCTGAGTGCT RNA ligation Zn2+ 
6J18 40 CGGGAGAGGAGTGGCAGAGATACTGTGAATGTAATCTGAG RNA ligation Zn2+ 
7S11 37 CAGTGCAGGGCGTGAGGGCTCGGTTCCCGTATTATCT RNA ligation Mg2+ 
7S10 37 CAGCGCAGGGTGTGAGGGCTCGGTTCCCGTATTATTT RNA ligation Mg2+ 
6CE8 20 GGCACTCAGAGCGCACGGCG RNA ligation Mn2+ 
8AY1 38 CCCGACGATGGAATGGAAGGGCGGGAGAGCCGCGGTAG RNA ligation Mg2+ 
8AY3 38 CAGCCTACGGGTAACAAGGTGCGAGAGATCAGCGGCAG RNA ligation Mg2+ 
8AY9 38 CACGAGATGTTTACCACGCTGCGGGAGATTAGCGGTAG RNA ligation Mg2+ 
8AY11 38 CACAAGGGAACAGGCTGCGTGTGAGAGAGTCGCGGTAA RNA ligation Mg2+ 
8AY13 38 CAGGTCGTTAGGCGGGAGATAACAAGGTGAAGCGGTAG RNA ligation Mg2+ 
8AY17 39 CACGGCAACAGCAACAGCAGTGCGAGAGAGACGCGGTAG RNA ligation Mg2+ 
8LX3 51 CCCACCGGTAGGGCTACGGGCAAGGTCAACATGCCGCAAGTGAGGGGTCG... RNA ligation Mn2+ 
8LX5 49 CAGGCCATGGATTATTGGAGGAATGGGCCGTCAGCGCGTGAGGTGTGGA RNA ligation Mn2+ 
10DM24 31 CCGTAGGTGAAGGGCGTGAGGGTTCCATTCC RNA ligation Mg2+ 
10-5 58 CTCCTCATTATTCACGAATGATAGCACGAATAGTGTGAACGGGTTGATTA... RNA ligation Mg2+ 
10-17 58 CTCCTCATTATTCTAGAATGATAGCACGAATAGTGTGAACGGGTTGATTA... RNA ligation Mg2+ 
10-4 56 CAGCTCATTATTCACGAATGATGCACGAATAGTGTGAACGGGTTGATTAT... RNA ligation Mg2+ 
10-12 58 AACCCTCATTATCCACCAATGATAGCACGAATAGTGTGAGCGGGTTGATT... RNA ligation Mg2+ 
10-14 56 AGGACTCATTAAGCTCGATTGCTCGAACGAACGGTTGGCACGGGTTGATT... RNA ligation Mg2+ 
10-8 57 CGCAGCATTATGCTCGCATGCCCGAACGAACGGTTGGCACGGGTTGATTA... RNA ligation Mg2+ 
10-2 57 CGACTGGTTTTGCTCGTTTCTTCGTAGGAACAGATGTAATGGGTTGATAT... RNA ligation Mg2+ 
10-10 56 CGACTGGCTCTGCTCGTTTCTTCGAATGAACAGATGTAGTGGGTTGATAT... RNA ligation Mg2+ 
10-16 57 CGACTAATCATGCTCGAATGTTCGTAAGAACAGTCTGTGCGGGTGGAATA... RNA ligation Mg2+ 
10-1 57 ACTGACTCATACTGCACGCTTGTCCCTAAGGTAGTTGCGCAGGTGGAATA... RNA ligation Mg2+ 
10-11 56 CTACGGGTTATGGTTGATTATACGTAAAAACAGTTAGGATGAGTTGTTGG... RNA ligation Mg2+ 
15HA9 31 CCGGCCACGGCGTCAGTGAGGCAAGACTTCC DNA ligation Mg2+ 
10DM3 31 CGGTAAGGCCAGGGCGTGAGGGTCCGCTTCC RNA ligation Mg2+ 
10DM5 31 CATTATGCGAAGGGCGTGAGGGTTCCGTTCC RNA ligation Mg2+ 
10DM19 31 CCTATGGCCCAGGGCGTGAGGGTGCGGTTCC RNA ligation Mg2+ 
10DM21 32 AGTGTGCTGCTAGGGCGTGAGGGTCCGCTTCC RNA ligation Mg2+ 
7DM3 31 CCGGCAGGCAAGGGTGTGAGGGCTCGGTTCC RNA ligation Mg2+ 
7DM11 31 CCGTAGGCAAAGGGCGTGAGGGCTCGGTTCC RNA ligation Mg2+ 
8BG11 40 CTACAGGACCCGCGCAAAAGTGATTTCAGAGGTATGGGTG RNA ligation Mg2+ 
8BG29 40 CTAACTGTCAGATTCATCTAAAGATGGGGGGTTGTTTGAC RNA ligation Mg2+ 
8BH6 38 GGCGTTAAGGATTGGCGGAAACGGGTGGATCGCGGACC RNA ligation Mg2+ 
12BK15 38 GGCCGCTCACCCGTAGAACGGGTTGGATCCTAGGGGAC RNA ligation Mg2+ 
12BK21 38 GTCCAAGTGCAAAAGTCTTGAAGCCACTGCTAGGGCAC RNA ligation Mg2+ 
12BK29 38 GGACAATGGCACACAGTGTGGTCAGGAACTAGGTGATA RNA ligation Mg2+ 
Seq01 115 TATGTGTCGATTGTGTTCTTTCGCTAGACCATGTGAGACTTATGCTTCGA... DNA ligation Zn2+ 
Seq02 115 TATGTGTCGATTGTGTTCTTTCGCTAGACCATGTGGGACTTATGCTTCGA... DNA ligation Zn2+ 
Seq03 116 TATGTGTCGATTGTGTTCTTTCGCTAGACCATGTGAGACTTATGCTTCGA... DNA ligation Zn2+ 
Seq04 117 TATGTGTCGATTGTGTTCTTCCGCTAGACCATGTGAGACTTATGCTTCGA... DNA ligation Zn2+ 
Seq05 116 TATAGTCAGGCTGGTAGGGTTCTTTCGCAGAGTGCGATGTGTTTTGATTT... DNA ligation Zn2+ 
Seq06 116 TATAGTCAGGCTGGTAGGGTTCTTTCGCAGAGTGCGATGTGTTTTGATTT... DNA ligation Zn2+ 
Seq07 116 TATAGTCAGGCTGGTAGGGTTCTTTCGCAGAGTGCGATGTGTTTTGATTT... DNA ligation Zn2+ 
Seq09 116 CGTTTCGTTTTGGAAGGCCTGTTGGTCCTTGTGTTCTCTCGCAGACCACT... DNA ligation Zn2+ 
Seq10 116 CGTTTCGATTTGGAAGGCCTGTTGGTCCTTGTGTTCTCTCGCAGACCACT... DNA ligation Zn2+ 
Seq11 116 CGTTTCGTTTTGGAAGGCCTGTTGGTCCTTGTGTTCTCTCGCAGACCACT... DNA ligation Zn2+ 
Seq13 115 CACGTACTTCTTGTAGACGTGTGGCTTTGATAGGATGTGGTCTTTCGCTA... DNA ligation Zn2+ 
Seq15 115 GTTTTTGTGTTTGACGAATACGTGTTCTTTCGCAGACCTTGTGCATCTTT... DNA ligation Zn2+ 
Seq16 116 TTGTGGTTGTGACCGGTTAGGATAGTGTTATTTCGCAGACCACATCACCG... DNA ligation Zn2+ 
Seq17 116 TTTGGTTTCGCAGTTGGTGTGTTCGTTCGCAGACCCTTTGGGTGAGATTG... DNA ligation Zn2+ 
Seq18 114 TGGGGATCGCGGTATTAGTGTGTGCGTACTTTGGCTGACGGTGGCCGTCG... DNA ligation Zn2+ 
Seq19 117 TTTCTTGGGCTTAAGCTCGGTTATTGTTCTTTCGCTAGATCCATGTCTAT... DNA ligation Zn2+ 
Seq20 116 TCAGGTGTTTTTGTTTTTCTGAGCAGGGAGTCGGTGTGTTCTTTCGCAGA... DNA ligation Zn2+ 
Seq21 115 GTCGGTTCATGTTGTTCTTTCGCCAGATGATCGCGGCGTTTTAGTTTACG... DNA ligation Zn2+ 
E47 47 CGGATAGTGTTCTTTCGCTAGACCATGTGACGCATGGTGAGATGCTT DNA ligation Zn2+ Cu2+ 
9Q1 22 GGAGACAGGTTCCGGATGCATG RNA ligation Mn2+ Mg2+ 
9Q2 22 GGAGATAGGTTCCAGCTGATTG RNA ligation Mn2+ Mg2+ 
9Q5 22 GGACCGATGGAGTGAACTATGC RNA ligation Mn2+ Mg2+ 
9Q9 22 ACGGACAGTTTCCGGAGCCGTG RNA ligation Mn2+ Mg2+ 
9R2a 22 GGTACGGGGCGTGCGGAGGCAC RNA ligation Mn2+ Mg2+ 
9R2b 22 GGTTCGGGGTATGCGGAGGCAT RNA ligation Mn2+ Mg2+ 
9R4a 22 GGACCGATGGAGTGAACTATGC RNA ligation Mn2+ Mg2+ 
9R6 22 GGACCATGTTGGAGCGGCCCAG RNA ligation Mn2+ Mg2+ 
9R7 22 GGACCATGGGGGAGCGGCCCGC RNA ligation Mn2+ Mg2+ 
9R16b 22 GGAGGATCGGACAGCGTTATCG RNA ligation Mn2+ Mg2+ 
9R20 22 GGAGCGACACACAGACCTGTTC RNA ligation Mn2+ Mg2+ 
10Q7b 22 GGAGGATCGTACAGCGTTATCG RNA ligation Mn2+ Mg2+ 
12BB33 40 TGTAGCCTTCTGAAGGTTGGCTGGTTCGGCGAGGTGGGAA RNA ligation Zn2+ 
8LV2 49 ATGACTGTAGGAGCGGACGCTAAGCCTTTAGACTCGCAGTGAGGTTCCG DNA ligation Mn2+ 
10-18 57 CTAACCATTATCCTCGATTGTTAGAGCGAACAGCTGCAACGGGTTGATTA... RNA ligation Mg2+ 
7Q5 19 TTTGTGGAGGTAAGCTCTG RNA ligation Mg2+ 
6CA30 40 CCCGTACGCTGCCATGGCGCCATTCTGGCACGTAGTGTTG RNA ligation Mn2+ 
6BX42 40 GCAGTGCTAATGAGGTATCGCAAATAAGTGCGCAGCCGAA RNA ligation Mn2+ 
7P4 20 TTCGGTGGAGGTAAGCTCTG RNA ligation Mg2+ 
7Q2 20 TTCTGCGCAGGTAAGCTGTA RNA ligation Mg2+ 
7Z48 40 ACGGGGCCGGTTTGCGTGCCTGATTGGGAGGTTAGCTCTA RNA ligation Mg2+ 
9A12 40 CTTTACGGTAGGGTGCCTGTGATAATGATCAGGGGACGGC RNA ligation Mg2+ 
9A2 40 TGCGTTCTGATGAATTGCACATAGCTTATAGTTCCTTGCT RNA ligation Mg2+ 
9F18 40 GGGATGTGGGGCGCCACCAAGTTAATGTTTGGTTTGGGGA RNA ligation Mn2+ Mg2+ 
7DE5 40 GTAGGGTTGGTAGACCAGGTTGAGCCGGCGTCCTTGTTTA RNA ligation Zn2+ 
8CW8 40 TACAAGGTGGGAGGAGGGAGCACCGATGCGGCATATCGTG RNA ligation Zn2+ 
12BB1 40 CCGCTCCGATTGGTGGAGTCTATTGGGGCCTGTAGGCGAG RNA ligation Zn2+ 
8CW13 40 GGGGAAGACAAGATAGTCGAGGGGGACGCGCTCTCAGCCT RNA ligation Zn2+ 
12BB5 40 CAGCGCGATTGAGTGCGTGATTGAAGCTCGGGGTTGGTTA RNA ligation Zn2+ 
12BB8 39 CACGCTGACTAGCTTCGTGAGGGGGTGTGATAGATGCGG RNA ligation Zn2+ 
6J2 40 TGCACGGGGGGTGAGGTTTCCGCCGTTGAAACGTAGCACG RNA ligation Zn2+ 
8LX1 50 GACGCCACCGAAGTCGCCATCTCCCGTAGGTGAAGGGCGTGAGGGTTCCA RNA ligation Mn2+ 
8LX6 50 CAGTGCAGGGCGTGAGGGCTCCATCCCCAGTGCAGGGCGTGAGGGCTCGG RNA ligation Mn2+ 
10-20 57 CTACCCATTATTCACGAATGATAGCACGAATAGTGTGAACGGGTTGATTA... RNA ligation Mg2+ 
10DM10 31 CCTGTGGCAAAGGGCGTGAGGGTACTGTTCC RNA ligation Mg2+ 
7DM12 31 CATTATGCCCAGGGCGTGAGGGTGCGGTTCC RNA ligation Mg2+ 
8BH41 39 AGGGACAAACCATAAGTCGCATCGGGTGGAACGTAGACC RNA ligation Mg2+ 
9HR17 49 CAGCTATATGTGCTGGACTGAGAGGGGTAGTTTCGCAGTGAGGTGTAGG RNA ligation Mg2+ 
Seq08 116 TATAGTCAGGCTGGTAGGGTTCTTTCGCAGAGTGCGATGTGTTTTGATTT... DNA ligation Zn2+ 
Seq12 116 CGTCTTGCTGGGTTTTTGCTCGGTATCGTTCTTTCGCTAGACCTTTAAAT... DNA ligation Zn2+ 
Seq14 116 GAGCGTGGCTAACTGGATAGTGGTCTCTCGCTAGACACCTGTGTGAGATT... DNA ligation Zn2+ 
9DB1 40 GGATCATACGGTCGGAGGGGTTTGCCGTGAACATTCTTCA RNA ligation Mg2+ 
SC8 40 GCGGGCCCCAATTCATTGGCTTAACTACGAGGACGTCCAG RNA ligation Mn2+ 
SC9 40 GTACGGACGTCAGTCACGAGGCAGCTGCTTTGCCAAACTG RNA ligation Mn2+ 
SC26 40 ACCGTCACAAAAGACTGTAGTTAATACCACTGCAGGTCGT RNA ligation Mn2+ 
SC34 40 GCACAGGGGTATAATTGCCTCGTACAACTTTATGTCCGAA RNA ligation Mn2+ 

Reactions

Name Description
RNA ligation

RNA-ligating DNAzymes can give different reaction products: linear RNA (native and non-native linkages), branched RNA (branched or lariat if the two substrates are connected), as well as some unnatural linkages. These DNAzymes are useful for the preparation of long RNAs for structural and functional studies. Different combinations of activated RNA substrates together with the appropriate DNAzyme can be used to achieve the desired ligated product.

DNAzymes for the formation of RNA linear linkages

For the formation of RNA native linkages, it is possible to join a 2’,3’-cyclic phosphate with a 5’-OH, or else, a 2’,3’-diol with a 5’-triphosphate. Using a 3’-OH group and a 5’-triphosphate, proteinaceous RNA polymerases, assisted by divalent cations, as well as the class I ligase and the L1 ligase ribozymes, catalyze the formation of a native RNA phosphodiester linkage.



DNAzymes for the formation of branched and lariat products

The preparation of branched or lariat RNAs, most commonly can be achieved when a 5'-triphosphorylated ribonucleotide attacks a 2’-OH group at the branching site. Natural 2',5'-branched RNA products are formed during pre-mRNA processing by the spliceosome.



DNA ligation

DNAzymes for the formation of DNA linear linkages

DNAzyme catalyzed formation of a native DNA linkage can be achieved upon condensation of the 5′–hydroxyl of one DNA substrate and the 3′-phosphorimidazolide of another DNA substrate. An alternative strategy requires, in the first place, the formation of a cap structure on the donor substrate (identical to that generated by T4 DNA ligase), and its subsequent reaction with the 3'-OH of the acceptor substrate to form the 3',5'-phosphodiester bond.



DNAzymes for the formation of branched DNA

DNAzyme catalyzed formation of a branched DNA is possible by joining the 2′-hydroxyl of the branch-site ribonucleotide of a DNA substrate to the activated 5′-phosphorus of a separate DNA strand. While the 5'-phosphorus is activated as a 5'-triphosphate for the synthesis of branched RNA, it is activated as a 5'-adenylate for the synthesis of branched DNA. These DNAzymes make use of a three-helix junction architecture, and examples of this family include 7S11 for the formation of branched RNA and 15HA9 for the formation of branched DNA.



Articles

Year of pub. First Author, Last Author Title
2003 Y Wang, S K Silverman Characterization of deoxyribozymes that synthesize branched RNA.
2010 F Wachowius, C Höbartner Combinatorial mutation interference analysis reveals functional nucleotides required for DNA catalysis.
2008 D M Kost, S K Silverman Controlling the direction of site-selectivity and regioselectivity in RNA ligation by Zn2+-dependent deoxyribozymes that use 2',3'-cyclic phosphate RNA substrates.
2005 Y Wang, S K Silverman Directing the outcome of deoxyribozyme selections to favor native 3'-5' RNA ligation.
2006 N Paul, G F Joyce Conversion of a ribozyme to a deoxyribozyme through in vitro evolution.
2004 T K Prior, S K Silverman Structure-function correlations derived from faster variants of a RNA ligase deoxyribozyme.
2011 F Wachowius, C Höbartner Probing essential nucleobase functional groups in aptamers and deoxyribozymes by nucleotide analogue interference mapping of DNA.
2005 W E Purtha, S K Silverman General deoxyribozyme-catalyzed synthesis of native 3'-5' RNA linkages.
2005 K A Hoadley, S K Silverman Zn2+-dependent deoxyribozymes that form natural and unnatural RNA linkages.
2005 R L Coppins, S K Silverman A deoxyribozyme that forms a three-helix-junction complex with its RNA substrates and has general RNA branch-forming activity.
2004 R L Coppins, S K Silverman Rational modification of a selection strategy leads to deoxyribozymes that create native 3'-5' RNA linkages.
2005 D R Semlow, S K Silverman Parallel selections in vitro reveal a preference for 2'-5' RNA ligation upon deoxyribozyme-mediated opening of a 2',3'-cyclic phosphate.
2001 Y Li, R R Breaker In vitro selection of kinase and ligase deoxyribozymes.
2009 S K Silverman, D A Baum Use of deoxyribozymes in RNA research.
1995 B Cuenoud, J W Szostak A DNA metalloenzyme with DNA ligase activity.
2003 A Flynn-Charlebois, S K Silverman In vitro evolution of an RNA-cleaving DNA enzyme into an RNA ligase switches the selectivity from 3'-5' to 2'-5'.
2019 J Aranda, M Orozco An artificial DNAzyme RNA ligase shows a reaction mechanism resembling that of cellular polymerases
2005 E D Pratico, S K Silverman A deoxyribozyme that synthesizes 2',5'-branched RNA with any branch-site nucleotide.
2000 Y Li, R R Breaker Capping DNA with DNA.
2003 B L Ricca, S K Silverman Optimization and generality of a small deoxyribozyme that ligates RNA.
2003 A Flynn-Charlebois, S K Silverman Deoxyribozymes with 2'-5' RNA ligase activity.
2016 A Ponce-Salvatierra, V Pena Crystal structure of a DNA catalyst.
2016 A J Camden, S K Silverman DNA Oligonucleotide 3'-Phosphorylation by a DNA Enzyme.
2013 A K Behera, A Baum Enhanced deoxyribozyme‐catalyzed RNA ligation in the presence of organic cosolvents
2013 F Javadi-Zarnaghi Lanthanide cofactors accelerate DNA-catalyzed synthesis of branched RNA.
2020 C P M Scheitl, C Höbartner New Deoxyribozymes for the Native Ligation of RNA.
2016 P-J J Huang, J Liu An Ultrasensitive Light-up Cu(2+) Biosensor Using a New DNAzyme Cleaving a Phosphorothioate-Modified Substrate.
2011 C S Lee, S K Silverman Improved deoxyribozymes for synthesis of covalently branched DNA and RNA.
2008 T P Mui, S K Silverman Convergent and general one-step DNA-catalyzed synthesis of multiply branched DNA.
2005 Y Wang, S K Silverman Efficient one-step synthesis of biologically related lariat RNAs by a deoxyribozyme.
2019 E J Mattioli, M Calvaresi DNAzymes at Work: A DFT Computational Investigation on the Mechanism of 9DB1
2003 Y Wang, S K Silverman Deoxyribozymes that synthesize branched and lariat RNA.
2004 R L Coppins, S K Silverman A DNA enzyme that mimics the first step of RNA splicing.
2005 R L Coppins, S K Silverman Mimicking the first step of RNA splicing: an artificial DNA enzyme can synthesize branched RNA using an oligonucleotide leaving group as a 5'-exon analogue.
2006 E Zelin, Scott K Silverman Adenosine is inherently favored as the branch-site RNA nucleotide in a structural context that resembles natural RNA splicing.
2007 C Höbartner, S K Silverman Engineering a selective small-molecule substrate binding site into a deoxyribozyme.
2008 P I Pradeepkumar, Scott K Silverman DNA-catalyzed formation of nucleopeptide linkages.

Structures

Structure Accession number
5CKI
5CKK
Copyright © Genesilico - All rights reserved
This website is free, open to all users and there is no login required.
If you have any advice or suggestions for corrections or improvements, please contact: Almudena Ponce Salvatierra