Search for RNA


DNAzymes

Name Length Enzyme region of the deoxyribozyme Reaction Metal Ions/cofactors
8LX12 50 CCCCGAGGTGTGGACATAGCGGGCTGGTGTGGCGCGCAGTGAGCCTAGTG RNA ligation Mn2+ 
8LX13 50 CATCGGTGTAGCGATGCACGGGCAAAGATACATTCGCAGTGAGGGTGCGG RNA ligation Mn2+ 
8LX14 50 CCACGTGCGAGGTTAGACGTCAGTGGCTGGTGTTCGCAGTGAGCCTATTG RNA ligation Mn2+ 
8LX15 49 CCGACGCGTCCAGGAGGCAAGGGCTATATGCACCGCAGTGAGGGCTCGG RNA ligation Mn2+ 
8LX16 50 CACGAGGTAGGGAGGGGCACACTGCTATGCTCAGCGCAGTGAGAGTATGC RNA ligation Mn2+ 
8LX17 48 CACATGTCTAGCGGCGTGCGGGAGAAGTGCAAGCGCTGTGAGGGTGTG RNA ligation Mn2+ 
8LX18 50 CCAAGGCAGAGCGTAGCCAGACAGCCGGGAGGTTCGCAGTGAGTGAATGG RNA ligation Mn2+ 
8LX21 50 GTAGCCACATTAGTGCGCTGCAACTGCTATGCAACGCAGTGAGAGGGTGC RNA ligation Mn2+ 
10-13 58 CTAACCACTATCCATGATTGTAAGAGCGGACAGCTGCAACGGGTTGATTA... RNA ligation Mg2+ 
10-9 57 CTAACCATTATCCTCGATTGTTAGAACGAACAGTTGCAACGGGTTGATTA... RNA ligation Mg2+ 
10-19 56 TAACCCATTATCTTCGATGTTAGAACGAACAGCTGCAACGGGTTGATTAT... RNA ligation Mg2+ 
10-15 57 CTCGCCATTATCCTTGAGTGTTAGAACGAACAGTTGCAACGGGTTGATTA... RNA ligation Mg2+ 
10-7 57 CTATGCATTATCCTTGACTGTTAGATCGAGCAGTTGCAACGGGTTGATTA... RNA ligation Mg2+ 
10-22 57 CTAACCATTATCCCTGATTGTTAGAACGAACAGTTGCGACGGGTTGATTA... RNA ligation Mg2+ 
10-6 57 CTACGCATTATCCCTGGTTGTTAGAACGAGCAGTTGCAACGGGTTGATTA... RNA ligation Mg2+ 
10-21 58 CAAACCATTATCCTCGATTGCAAGAACGAGCAGTTGGAACGGGTTGATTG... RNA ligation Mg2+ 
10-3 58 CATATTCATCATCCTCGACTGCAAGAAAGAACAGTTGGAACGGGTTGAAT... RNA ligation Mg2+ 
6CA4 40 CACGTGGACTTGGCATGGTCCCAGCGCTAGTTTTAAGCGC RNA ligation Mn2+ 
6CA6 40 CCCGTACACGACTGTGGTGTTGAACGGCTGCTAGCCGGCA RNA ligation Mn2+ 
8LX8 49 CCGACGAGGTGAGGGGCATGCGGTACACGCGCATATAGTGAGGGGTCCA RNA ligation Mn2+ 
6CA15 40 CCCGTGACATTCATATGGGGTCGGTTCCAATCGCGAATTA RNA ligation Mn2+ 
6CA16 40 CCCGTACACTCGACGTGGTGACGCTGTGGCGTGAGCCTGT RNA ligation Mn2+ 
Clone83 49 TGCAGTCGGGTAGTTARACCGACCTTCAGACATAGGCAGGCGTATATCT RNA cleavage UO22+ 
6CA18 41 CAGAGATGGGGTGTGATCTGGGTTGATAACACGGAGCGGTC RNA ligation Mn2+ 
6CA21 41 CCCGTACACTTAGAATGGTGCAGCCAGCATGCTGTACAGTA RNA ligation Mn2+ 
6CA23 40 CCCGTGCACTCTATGATGGTGTCCCCTGATACCAACAGGG RNA ligation Mn2+ 
6CA27 40 CACGTGACCTCAGGAATGGGTTCGAGGTGGGTGCACCTGC RNA ligation Mn2+ 
9BX1 40 GGAACGCAGTCGCACGTGACTAGGGAATCGTATCCTCATG RNA ligation Mn2+ 
9BX3 40 CGTGGTTTCCGGAATGCCTAGCGTTCAAGTGTGGATGCTT RNA ligation Mn2+ 
9BX4 40 CCGCGAGGCCGTGGCCCGAGTTGGTCAAAGCACAACGAGT RNA ligation Mn2+ 
9BX10 40 GATGTGGTCCAGCTGATAGGGCAGCGTTAGGCATACGTTG RNA ligation Mn2+ 
9BX15 40 GCGACGGATTTAGGTGTGTTAGACAGGGTCGGGAATAGAT RNA ligation Mn2+ 
9BX16 39 GCAGCGGGGAAGGCACTTCCAGGCAGGGGGGAAAAACAA RNA ligation Mn2+ 
6BX6 40 CGAGGCGTAGGTTAATTACAAACGGCTCAGACAACGTATG RNA ligation Mn2+ 
6BX35 40 GGCGAAGGGACTACGTTGGCCATGCGGGTGGGCCGCTATG RNA ligation Mn2+ 
6BX39 40 GAACGTGAGGTGCGGGAATTAATCACAAACCGGAAACGGA RNA ligation Mn2+ 
6BX43 40 CACCACAATGGTTGATGCCGGGCCAAGTGGCGCAGCATAC RNA ligation Mn2+ 
6BX45 40 CGCACGGAGCCCGTTAGGGGTCCACGGAGTGGGTGAACCT RNA ligation Mn2+ 
6BX47 40 CCGGGCATCAAGTGCGCAACGATGACGAAATCGGGTGGGT RNA ligation Mn2+ 
6BX20 40 CGCACGGTCTGGTGTGGAAGCCAGGTTGCCTCCCTGCAAA RNA ligation Mn2+ 
6BX22 40 CAGGGGGAGCGAGCACTAATACAAGCGGGTAGGAGGCCCT RNA ligation Mn2+ 
6BX23 40 CGGGAGGAGGCAAAGGCTAGTTTGTCGGATAGGAGGCCCT RNA ligation Mn2+ 
6BX34 40 CGTGGGAGCCATTGGGAGGGGCTGAGAACATAAGTCACGA RNA ligation Mn2+ 
6BX8 40 GCAGTGCAAATGAGGCATGGAGAAACTACTCTATGCTGAA RNA ligation Mn2+ 
6BX16 40 GCAGTGCAAATGAGTAAGGACTGATATCAGTCACTACGAA RNA ligation Mn2+ 
6BX40 40 GCAGTGCTAATGAGGGTGTGGCAGAAGCTATACAGCCGAA RNA ligation Mn2+ 
6BX19 40 GACGGGTGGGGAAATCAGCCTGTATTGGGTTCAGAGCGGA RNA ligation Mn2+ 
6BX21 40 GACGACAGCGGTTCCCAGCTCAGTAGTGATAGTTTACTGC RNA ligation Mn2+ 
6BX26 40 GACACCGAGCAGAGGACCGGACCTAGTTGGTAAAAGGTAA RNA ligation Mn2+ 
6CA17 40 CACAGGCGCGCGAGGGGCTATGTCCGGTGGTGCAGGCGGA RNA ligation Mn2+ 
6CA28 40 CGGAAGGATGACAAGGAGCGTAGCTGATGGGGACTCAGAC RNA ligation Mn2+ 
6CA2 40 GGGGCGTAGTGGAGACCGGGGACAGTGGAGTACGTCCAGC RNA ligation Mn2+ 
6CA20 40 GTTAACGCAGGGCGTCGTACTACATCCTTGTGCAGCTACG RNA ligation Mn2+ 
6CA1 41 TGAAGCGCGTTATCCATGCAAAAAATGGATCCGGTACCAAC RNA ligation Mn2+ 
6CA5 40 TGCAGCGGCTGCGCGGGTATCCGGTCTCCAGGGGACGCTT RNA ligation Mn2+ 
6CA7 40 AGACCCAGTGTTCTCAGCCGCCCGCCGCAGCGGGGAGGTA RNA ligation Mn2+ 
6CA14 40 CGAAGACGAGGAGTAACCTTAGATGAAGGTGGGGACGATT RNA ligation Mn2+ 
6CA24 40 GGGCGAGGACCGGGTACTAGGGGAACACGCCGCACGCGGG RNA ligation Mn2+ 
6CA25 40 AGACGCAGTGTCAGGGTACCACAGACATGTGGAGTGGCTG RNA ligation Mn2+ 
9BX11 40 CATGCGTGTTGCGTGGATACGAGGCTATTCAGAGGGTAAA RNA ligation Mn2+ 
6CA10 40 CACGTACACTTGGTATGGTGTGACACCTCAGCTCATACAT RNA ligation Mn2+ 
7Q10 20 TTACGTGGAGGTGGGCTCTA RNA ligation Mg2+ 
7Z81 38 ACGGCGAGTTTCATGGAGTGATTGGGAGGTTAGCTCTA RNA ligation Mg2+ 
12BB27 40 CCGCTCCGATTGGTGAAGTCTATTGGGGCCTGTAGGCGAG RNA ligation Zn2+ 
7Z101 40 CCCGAGGAGGGGCGGGGGGACTTGGTGTGGAGTTTCATTC RNA ligation Mg2+ 
9A5 40 AAGGGGAGGGCCGATTGGCATTATCGGCGTCTTAGCTCTA RNA ligation Mg2+ 
9A6 39 TAACCGTGGTTACCGTAAGCGCGGGGCTTATAGGGGATT RNA ligation Mg2+ 
9DB1* 31 GGATCATACGGTCGGAGGGGTTTGCCGTTTA RNA ligation Mn2+ Mg2+ 
9F21 40 AATGATGCTTGACAGGGTCTATAGTTTCTATGTAGCCCGA RNA ligation Mn2+ Mg2+ 
9F13 38 AGGATGTGGGGTTTTGCCCGAGGGTATGGCAGTGGGGA RNA ligation Mn2+ Mg2+ 
7CX2 40 GTGAGAGCCATTGTGCATTGTGGTGCAACTGTACGCGCCT RNA ligation Zn2+ 
7CX3 40 GTGAGAGCAGGTTTGGCACGCGTGCCACTAACCCGCGCCT RNA ligation Zn2+ 
7CX4 40 GTGGGAGCCTGATGGAAGAATGGGAGAACAGCACGCGCCT RNA ligation Zn2+ 
7CX5 40 GGGAGAGCTAGGAGGCGCTGAGTCTCGGCTCCTCGCGCCT RNA ligation Zn2+ 
7CX6 40 GTGAGAGCAAGCGAGGGATACATGAACCGAAACCGCGCCT RNA ligation Zn2+ 
7CX7 40 GTGAGAGCAGTAAACGGAAGGCCTCTTCCTGTCCGCGCCT RNA ligation Zn2+ 
7CX8 40 GTGAGAGCATGTGGCACCCTGGCAGGAACCTAACGCGCCT RNA ligation Zn2+ 
7CX9 40 ACTGAGAGCCTCGATGAATGCCTAATTATATCGTCGCGCC RNA ligation Zn2+ 
7CX10 40 GTGAGAGCAATACGTATGAAGATATTGAAGTTTCGCGCCT RNA ligation Zn2+ 
7CX12 40 GTGAGAGCATCACTGTAACCGCCGTGCGGTGGACGCGCCT RNA ligation Zn2+ 
7CX13 39 GGGAGAGCAGTTATGATGCATGAGCCATTGACCGCGCCT RNA ligation Zn2+ 
7CX14 40 GGGAGAGCAGCGATGCAAGACATTGGGGCGGAGCCGCGCT RNA ligation Zn2+ 
7CX21 39 TGAGAGCATTTCCGGCGGAGCTCTACGGGGGCCGCGCCT RNA ligation Zn2+ 
7CX11 40 TTTAGTCAGGAGTAGACATCGATGATTGCTAATCGAACCT RNA ligation Zn2+ 
8CW1 40 GTGAGAGAACCGCGGTGTAGACACAGATCGCGGCGCGCCT RNA ligation Zn2+ 
8CW11 39 GGGAGAGCAGTTATGACGCATAAGCTATTGACCGCGCCT RNA ligation Zn2+ 
8CW15 40 GTGAGAGCAATCACTTTGGGTAGGTACGGGTGAACGCGCT RNA ligation Zn2+ 
8CW16 40 GTTAGAGCCAAACACGTTTGTGTCAGCGGGTTTCGCGCCT RNA ligation Zn2+ 
8CW20 40 GGAAGAGCAATGTACTCCGACGTCAGAGGATATCGCGCCT RNA ligation Zn2+ 
8CW3 40 ACGCCCACCATTTAAGAGCATCGCCGGAATAGCGGGGACT RNA ligation Zn2+ 
12BB26 40 ACTATACCACCGAGATTCGAATTGGAGCAGTAGTGGCTTG RNA ligation Zn2+ 
12BB36 40 ACCGGTCCCTGTCGGTCGAAGGAGTGGCACTGAGGAGAAT RNA ligation Zn2+ 
8CW4 40 GCACGGCCGGATTGGGGGGCCCAATGACTTGATCATTGCT RNA ligation Zn2+ 
12BB41 40 ACGCGAGGGGAGTTCAATCGCTTGTTCGGCAAGGTCGGGA RNA ligation Zn2+ 
8CW9 40 ACACGCGTTACGGACTGAGCAGATTCAGGCCAAACTGCCT RNA ligation Zn2+ 
9F7 40 AATGAGGCTTGGCAGGGATTTAGTATTTTAACACTCCCGG RNA ligation Mn2+ Mg2+ 
12BB2 40 ACCGCGGGAGCTACGTTAGTGGTAACTGCTTGTAGGCGAG RNA ligation Zn2+ 
8CW12 39 ACATGTGCGGTAATGAGGCGTAGACAAATAGAGATACCT RNA ligation Zn2+ 
12BB21 41 AAGGCAGCAGGCGGCATTTTTTGTCCGTACGTTCTCCTATA RNA ligation Zn2+ 
12BB22 40 ACCGCGGGAGTTTCGTTAGTGGTGACTGCTTGTAGGCGAG RNA ligation Zn2+ 
12BB25 40 GTAGAGTGGTTCCGGTTATCGCCTTAGATACCATTGCTGT RNA ligation Zn2+ 
8CW14 40 GCGGGGTTAAGCCACGAATGCGGGGCAAAGCGTACCCCCT RNA ligation Zn2+ 
12BB38 40 CCGCTGCGGAGGTTGTACGCGTCTGTGGCTTGTAGGCGAG RNA ligation Zn2+ 
12BB6 40 TACACCTATTATGGTTTCGTGAGGGGTGTGGCTGGTGCTG RNA ligation Zn2+ 
12BB12 40 CAGAGCCCCTTACGTACAGCCTTTTTAGGTAACCGGGGAG RNA ligation Zn2+ 
12BB24 40 CAGCGCGATTGGGGGCGTGATTGAAGCTCGGGGTTGGTTA RNA ligation Zn2+ 
12BB23 40 TACACCTATAATGGTTTCGTGAGGGGTGTGGCTGATGCTG RNA ligation Zn2+ 
12BB30 40 CCTGTACTGCGCTGCTCAAATCAGCCGGGTGTGTGAACTC RNA ligation Zn2+ 
12BB32 40 TGTATGTGGGGGGTGTGTATCAGTCTACTGTGGCTTAAGC RNA ligation Zn2+ 
6J12 40 AGGGAGCGGTGTGGCACAGACAGGGTATTAACTCTGTGAG RNA ligation Zn2+ 
6J1 40 GTGGGAGGACGCGTCAGTAGTTATGACCTGCCTGAGTGCT RNA ligation Zn2+ 
6J18 40 CGGGAGAGGAGTGGCAGAGATACTGTGAATGTAATCTGAG RNA ligation Zn2+ 
7S11 37 CAGTGCAGGGCGTGAGGGCTCGGTTCCCGTATTATCT RNA ligation Mg2+ 
7S10 37 CAGCGCAGGGTGTGAGGGCTCGGTTCCCGTATTATTT RNA ligation Mg2+ 
6CE8 20 GGCACTCAGAGCGCACGGCG RNA ligation Mn2+ 
8AY1 38 CCCGACGATGGAATGGAAGGGCGGGAGAGCCGCGGTAG RNA ligation Mg2+ 
8AY3 38 CAGCCTACGGGTAACAAGGTGCGAGAGATCAGCGGCAG RNA ligation Mg2+ 
8AY9 38 CACGAGATGTTTACCACGCTGCGGGAGATTAGCGGTAG RNA ligation Mg2+ 
8AY11 38 CACAAGGGAACAGGCTGCGTGTGAGAGAGTCGCGGTAA RNA ligation Mg2+ 
8AY13 38 CAGGTCGTTAGGCGGGAGATAACAAGGTGAAGCGGTAG RNA ligation Mg2+ 
8AY17 39 CACGGCAACAGCAACAGCAGTGCGAGAGAGACGCGGTAG RNA ligation Mg2+ 
8LX3 51 CCCACCGGTAGGGCTACGGGCAAGGTCAACATGCCGCAAGTGAGGGGTCG... RNA ligation Mn2+ 
8LX5 49 CAGGCCATGGATTATTGGAGGAATGGGCCGTCAGCGCGTGAGGTGTGGA RNA ligation Mn2+ 
10DM24 31 CCGTAGGTGAAGGGCGTGAGGGTTCCATTCC RNA ligation Mg2+ 
10-5 58 CTCCTCATTATTCACGAATGATAGCACGAATAGTGTGAACGGGTTGATTA... RNA ligation Mg2+ 
10-17 58 CTCCTCATTATTCTAGAATGATAGCACGAATAGTGTGAACGGGTTGATTA... RNA ligation Mg2+ 
10-4 56 CAGCTCATTATTCACGAATGATGCACGAATAGTGTGAACGGGTTGATTAT... RNA ligation Mg2+ 
10-12 58 AACCCTCATTATCCACCAATGATAGCACGAATAGTGTGAGCGGGTTGATT... RNA ligation Mg2+ 
class 17_sel_b 74 TAGGCACCGTAGACGCATGACGTATCGGAAGTTTGAGAGGCGGGCTTACC... RNA cleavage
10-14 56 AGGACTCATTAAGCTCGATTGCTCGAACGAACGGTTGGCACGGGTTGATT... RNA ligation Mg2+ 
10-8 57 CGCAGCATTATGCTCGCATGCCCGAACGAACGGTTGGCACGGGTTGATTA... RNA ligation Mg2+ 
10-2 57 CGACTGGTTTTGCTCGTTTCTTCGTAGGAACAGATGTAATGGGTTGATAT... RNA ligation Mg2+ 
10-10 56 CGACTGGCTCTGCTCGTTTCTTCGAATGAACAGATGTAGTGGGTTGATAT... RNA ligation Mg2+ 
10-16 57 CGACTAATCATGCTCGAATGTTCGTAAGAACAGTCTGTGCGGGTGGAATA... RNA ligation Mg2+ 
ie7 39 ATCAGCGATTCACCCTTGTTTAGGGTTGCACCCATGTTA RNA cleavage Mg2+ 
10-1 57 ACTGACTCATACTGCACGCTTGTCCCTAAGGTAGTTGCGCAGGTGGAATA... RNA ligation Mg2+ 
10-11 56 CTACGGGTTATGGTTGATTATACGTAAAAACAGTTAGGATGAGTTGTTGG... RNA ligation Mg2+ 
10DM3 31 CGGTAAGGCCAGGGCGTGAGGGTCCGCTTCC RNA ligation Mg2+ 
10DM5 31 CATTATGCGAAGGGCGTGAGGGTTCCGTTCC RNA ligation Mg2+ 
10DM19 31 CCTATGGCCCAGGGCGTGAGGGTGCGGTTCC RNA ligation Mg2+ 
10DM21 32 AGTGTGCTGCTAGGGCGTGAGGGTCCGCTTCC RNA ligation Mg2+ 
7DM3 31 CCGGCAGGCAAGGGTGTGAGGGCTCGGTTCC RNA ligation Mg2+ 
7DM11 31 CCGTAGGCAAAGGGCGTGAGGGCTCGGTTCC RNA ligation Mg2+ 
8BG11 40 CTACAGGACCCGCGCAAAAGTGATTTCAGAGGTATGGGTG RNA ligation Mg2+ 
8BG29 40 CTAACTGTCAGATTCATCTAAAGATGGGGGGTTGTTTGAC RNA ligation Mg2+ 
8BH6 38 GGCGTTAAGGATTGGCGGAAACGGGTGGATCGCGGACC RNA ligation Mg2+ 
12BK15 38 GGCCGCTCACCCGTAGAACGGGTTGGATCCTAGGGGAC RNA ligation Mg2+ 
12BK21 38 GTCCAAGTGCAAAAGTCTTGAAGCCACTGCTAGGGCAC RNA ligation Mg2+ 
12BK29 38 GGACAATGGCACACAGTGTGGTCAGGAACTAGGTGATA RNA ligation Mg2+ 
G5_2 50 GGGGGGAACGCCGTAACAAGCTCTGAACTAGCGGTTGCGATATAGTCGTA RNA cleavage Pb2+ 
class 6 71 TAGGAAGTAGGGACCTACAAGTTGTCATTGTAACTGAGTTCTGCCAGCTG... RNA cleavage Mg2+ 
G5_3 50 CGGGACTCCGTAGCCCATTGCTTTTTGCAGCGTCAACGAATAGCGTATTA RNA cleavage Pb2+ 
G5_4 50 CCACCATGTCTTCTCGAGCCGAACCGATAGTTACGTCATACCTCCCGTAT RNA cleavage Pb2+ 
G5_5 50 GCCAGATTGCTGCTACCAGCGGTACGAAATAGTGAAGTGTTCGTGACTAT RNA cleavage Pb2+ 
G5_6 50 ATAGGCCATGCTTTGGCTAGCGGCACCGTATAGTGTACCTGCCCTTATCG RNA cleavage Pb2+ 
G5_9 51 TTGCTAGCTCGGCTGAACTTCTGTAGCGCAACCGAAATAGTGAGGCTTGA... RNA cleavage Pb2+ 
G5_mini* 38 ACACATCTCTGAAGTAGCGCCGCCGTATAGTGACGCTA RNA cleavage Pb2+ 
E0 40 TTCAGCGATGCACGCTTGTTTTAATGTTGCACCCATGTTA RNA cleavage Mg2+ 
E1 40 TACAGCGATTAACGCTTATTTTAGCGTTACACCCATGTTA RNA cleavage Mg2+ 
E2 40 TTCAGCGATTAACGCTTATTTTAGCGTTACACCCATGTTA RNA cleavage Mg2+ 
E5 33 TTCAGCGATTAACGGAACGTTACACCCATGTTA RNA cleavage Mg2+ 
E6 29 TTCAGCGATCCGGAACGGCACCCATGTTA RNA cleavage Mg2+ 
ie1 40 ATCAGCGATTAACGCTTATTTTAGCATTACACCCATGTTA RNA cleavage Mg2+ 
ie3 40 ATCAGCGATTAACGCTTATTTTAGCGTTACACCCATGTTA RNA cleavage Mg2+ 
ie5 40 ATCAGCGATTAACGCTTGTTTCAATGTTACACCCATGTTA RNA cleavage Mg2+ 
ie6 40 ATCAGCGATTAACGCTTGTTTTAGTGTTGCACCCATGTTA RNA cleavage Mg2+ 
ie8 40 TACAGCGATTCACCCTTGTTTAAGGGTTACACCCATGTTA RNA cleavage Mg2+ 
ie9 40 ATCAGCGATTCACCCTTGTTTTAAGGTTGCACCCATGTTA RNA cleavage Mg2+ 
ie10 40 TTCAGCGATTCACCCTTGTTTTAAGGTTACACCCATGTTA RNA cleavage Mg2+ 
ie11 40 TACAGCGATTCACGATTGTTTTAACGTGACACCCATGTTA RNA cleavage Mg2+ 
ie12 40 TACAGCGATTCACGCCTGTTATATGCGTGCACCCATGTTA RNA cleavage Mg2+ 
ie13 39 TACAGCGATAACGCCTATTTTAGCGTTACACCCATGTTG RNA cleavage Mg2+ 
ie14 40 TACAGCGATCAACGCCTGTTATAATCGTGCACCCATGTTA RNA cleavage Mg2+ 
ie15 40 ATCAGCGATCAACGCTTCTCTTAACGTTGCACCCATGTTA RNA cleavage Mg2+ 
ie16 40 TACAGCGATCAACACTTGTTTCAATGTTGCACCCATGTTA RNA cleavage Mg2+ 
ie17 40 ATCAGCGATCCACGCTTATTTAAACGTGGCACCCATGTTA RNA cleavage Mg2+ 
ie18 40 TACAGCGATCCACGCTTGATTAAACGTGGCACCCATGTTA RNA cleavage Mg2+ 
ie19 41 TATCAGCGATACACGTTTTTTTTAATGTGGCACCCATGTTA RNA cleavage Mg2+ 
class 1 74 AAGCTCTCTCAGCGAGACGAAATAGGGAGTTAGCAGCACGAGGTTACACT... RNA cleavage Mg2+ 
class 3 74 GGCATGTACCCAAGAAGGGGTGGAGCCGGCAGTGACCCCTGCGAGTAGGG... RNA cleavage Mg2+ 
class 4 74 ATGCTGTTGCTCTGTCAGCGGACACGAAATAGTGGGTCGCGATGCTGAAT... RNA cleavage Mg2+ 
class 5 72 CAGATGTGAAGTTAGAGCTTTGCCAGCnTCGTTAGTAGAGTCAGCGCACA... RNA cleavage Mg2+ 
class 7 71 CGTCATGCGAAAAGAATGGTGAGATTTGCCAGCsGTCGAGTAGTAGTCCA... RNA cleavage Mg2+ 
class 8 74 AGAACGGTAGAGTGCNGGGGGTGCAGTTGAGCTTTGTCAGCsACACGAAT... RNA cleavage Mg2+ 
class 9_sel_b 73 GAGCCTGTTAGGAAGAGCTTACCCAAGAAGGGGTGGAGCCGCGACGTTAG... RNA cleavage
class 10_sel_b 73 GCAGAGTAAGGGAACCCTCTGACGGGCCTATCGCTGCAGTATGAGCTTAC... RNA cleavage
class 11_sel_b 74 TTGAAAGCAGTTGGACGAAGCTTACCCAAGAAGGTGTGGCAGACGGGCAT... RNA cleavage
class 12_sel_b 74 TCGCTAGAACGCTGGGCTTACCCAAGAAGGGGTGGGTCGGACGCTAGTAA... RNA cleavage
class 13_sel_b 74 AGGCsCGCTTACCCAAGAAGGTGGGGGTACGAACATGCGAATCACTCTTG... RNA cleavage
class 15_sel_b 74 ATTGAGCTTACCCAAGAAGGGGTGTsCCGTTACCGTCTAGGGGGTATCTA... RNA cleavage
class 16_sel_b 74 CGTCAATTTGTATTCAAGCGGCGACTGAAGGTTAAAGCTTACCCAAGAAG... RNA cleavage
class 18_sel_b 74 CTTGAGGGGTAGGTATGGCCTACTGCTCCAAATCCTCACGATCGGTGCAG... RNA cleavage
class 20_sel_c 74 GGAATCATAGTGTTGGACAAACATGCGCCATGTCCAGGCGGACGTTACCC... RNA cleavage
class 21_sel_c 71 TGCCGTGGGCAGCGGACGTTACCCAAGAAGGTGTGGGACGACACTATACC... RNA cleavage
class 22_sel_c 74 GTGTACCAATACCGTCACTGAGCTTACCCAAGAAGGGGTGGATACAGCCT... RNA cleavage
class 23_sel_c 74 ATAGTCACTAATTGGCTACTAAACCAGGCCGAGCTTACCCAAGAAGGGGG... RNA cleavage
class 24_sel_c 69 CGTGGCAGCGGACGTTACCCAAGAAGGTGTGGGATGACACTATACCATAT... RNA cleavage
class 25_sel_c 73 CGCTACAGTTAAGGGAACCAAGGCGGGTGTCCGGTAGAGCTTACCCAAGC... RNA cleavage
class 1 40 TTTTGTCAGCGACTCGAAATAGTGTGTTGAAGCAGCTCTA RNA cleavage Zn2+ 
class 2 39 TAGTTCTACCAGCGGTTCGAAATAGTGAAGTGTTCGTGA RNA cleavage Zn2+ 
class 3 40 CAAAGATGCCAGCATGCTATTCTCCGAGCCGGTCGAAATA RNA cleavage Zn2+ 
unclassified 1 40 GTCTCCGAGCCGGTCGAAATAGTCAGGTGTTTCTATTCGG RNA cleavage Zn2+ 
unclassified 2 40 CTTCTCCGAGCCGGTCGAAATAGTAGTTTTTAGTATATCT RNA cleavage Zn2+ 
unclassified 3 40 AGGTGTTGGCTGCTCTCGCGGTGGCGAGAGGTAGGGTGAT RNA cleavage Zn2+ 
8-17 14 TCCGAGCCGGACGA RNA cleavage Mg2+ Zn2+ Pb2+ Ca2+ 
G1 35 TTTACCCAAGAAGGGGTGCGTACTTTACTTGCGAT RNA cleavage
G2 31 TTTACCCAAGAAGGGGTGCGTACTTACTTGC RNA cleavage
G3 41 TTTACCCAAGAAGGGGTGCGTACTATGCTACCTTATTAACG RNA cleavage
G4 39 TTTACCCAAGAAGGGGTGCGTACTATGCTACCTTATGAC RNA cleavage
G5 41 TTTACCCAAGAAGGGGTGCGTACTATGCTACCTTATGACGT RNA cleavage
G6 33 TTTACCCAAGAAGGGGTGCGTACTATACTACTC RNA cleavage
G7 39 TTTACCCAAGAAGGGGTGGCATGAGCGCTACCCAGCACA RNA cleavage
G8 39 TTTACCCAAGAAGGGGTGGCTAGAGCGCTACCCAGCAGA RNA cleavage
C1 39 CCCCAACTTGAATCCGGTTCGCAAAGTTGCTTACATCTC RNA cleavage
T1 39 CCTGCGCACTCCGGTTCGTTCCGGCACTATTTATTCAAG RNA cleavage
T2 39 CCTGCGCACTCCGGTTCGTTCCGGCACTATTTATTCATC RNA cleavage
T3 38 CCTGCGCACTCCGGTTCGTTCCGGCACTATTTATTCAT RNA cleavage
T4 35 CCTGCTTCTCCGGTTCGTTACCGACATCATTCATT RNA cleavage
Na2 37 TTTACCCAAGAAGGGGTGCCTACTtTGCCACCATATT RNA cleavage
Na3 40 TTTACCCAAGAAGGGGTGCGTTCAATGCTACCTTATTAAC RNA cleavage
10-23 16 RGGCTAGCTACAACGA RNA cleavage Mg2+ 
Na4 41 TTTACCCAAGAAGGGGTGGACTGAGCGCCTACCCAGCAGAG RNA cleavage
Na6 39 TTTACCCAAGAAGGGGTGCTACTATGTTACCTTATTACG RNA cleavage
Na9 41 TTTACCCAAGAAGGGGTGCTTCACTATGCTACGTAATTAAC RNA cleavage
Na10 41 TTTACCCAAGAAGGGGTGCGTACTATAGCGACCGTATTAAC RNA cleavage
Na13 40 TTTACCCAAGAAGGGGTGCGCACTAGACTACCTTATAACT RNA cleavage
Na15 43 TTTACCCAAGAAGGGGTGCGGACTTGGCTTCATTATTAATTGA RNA cleavage
Na19 40 TTTACCCAAGAAGGGGTGCTACTAAGCCTACTTTATTACC RNA cleavage
Na14 40 TTTACCCAAGAAGGGGTGCTACATGTACTTATAACTTCGA RNA cleavage
Na16 39 CCCAAGAAGGGGTGCGTAAACTGCTACCCTATTAACCTA RNA cleavage
Na1 42 TTTGTACCCAAGAAGGGGTGATACTAGGCTACCGTGTTAACG RNA cleavage
Na18 43 TTTGACCCAAGAAGGGGTGCATACTTAGCTGACCTTATTCAAC RNA cleavage
Na22 40 TTTACCCAAGAAGGGGTGCCTACAATGCTACCTGTTCACG RNA cleavage
Na23 42 TTTACCCAATAAGGGGTGCCTACTCTGCTACGTTATTTAACG RNA cleavage
Na17 37 TTACCCAAGAAGGGGTGCCTAATTGCTACTCACAAAC RNA cleavage
Na8 41 TTGACCCAAGAAGGGGTGACTACTTTGCTACGTTATTCCAC RNA cleavage
VMA15 20 AAAGGGCGGGCAAACTCTGG RNA cleavage Mg2+ 
Clone24 49 ATTCATCGCGCGTTACGCGACTTCAAACGTAGGGAGGCGGCTGGTAGTT RNA cleavage UO22+ 
VMA8 21 AGTCGGCCCCAGCTGGTTCGC RNA cleavage Mg2+ 
VMA11 20 GAGGGTTTCTAGGGGACGTG RNA cleavage Mg2+ 
VMA14 21 GGTCTAGTGGGTTCCTGGCTC RNA cleavage Mg2+ 
VMA1 20 AAGGATTGCCGGAACTGGGG RNA cleavage Mg2+ 
VMA2 20 TTGCGTAGCGCCTGGGCACC RNA cleavage Mg2+ 
VMA5 19 GGGGTATCGGGGGGTGTAC RNA cleavage Mg2+ 
VMB1 20 GGTCTCGCGGGGCCTGGCTC RNA cleavage Mg2+ 
VMB39 20 GGTCTTGCGGGTCCTGGCTC RNA cleavage Mg2+ 
VMB15 21 AAGGATCCGAGCAACTTCGGC RNA cleavage Mg2+ 
VMB10 20 GATTCCAGGGCTTGAGGAGG RNA cleavage Mg2+ 
VMB33 20 GGAGCGCAGTCTGTTGGGGG RNA cleavage Mg2+ 
VMC10 20 GGGTCTCCAGCTGGACGTTA RNA cleavage Mg2+ 
VMC6 20 GGTCTCGCGGGTCCTGGCTC RNA cleavage Mg2+ 
VMC17 20 GGTTCGGTTGAGTGGGGCGA RNA cleavage Mg2+ 
VMC1 20 GCGTGGCGTGGGACCGATGG RNA cleavage Mg2+ 
VMC4 20 AGATCGGTGACGTCGTTGTG RNA cleavage Mg2+ 
VMD1 21 CAGGACCCGAGCAACTTCGGC RNA cleavage Mg2+ 
VMD35 20 GGGATTCCAGCTGGACGTTG RNA cleavage Mg2+ 
VMD3 20 CGGCAGGGTCGGCACACGCG RNA cleavage Mg2+ 
VMD13 20 ACAGGAGCGGGTGGCCATGG RNA cleavage Mg2+ 
VMD32 19 GGCGGTGTGATCCAGGCAG RNA cleavage Mg2+ 
VMD43 20 GGAGCCAGTCTAGTGGGGGG RNA cleavage Mg2+ 
class I 39 GTTGGGTCACGGTATGGGGTCACTCGACGAAAATGCCGG RNA cleavage
class II 39 AGGATTGGTTCTGGGTGGGTAGGAAGTTAGTGTGAGCCG RNA cleavage Histidine 
class III 40 CGGGTCGAGGTGGGGAAAACAGGCAAGGCTGTTCAGGATG RNA cleavage
class IV 40 AGGATTAAGCCGAATTCCAGCACACTGGCGGCCGCTTCAC RNA cleavage
HD1 39 GCAGTTGGGTCTGGTTGGGTAGGAAGTTAATGTGAGACG RNA cleavage Histidine 
HD2 36 TTGATCGGGGCTGTGCGGGTAGGAAGTAATAGTGAG RNA cleavage Histidine 
HD3 35 TTAACGGGGCTGTGCGGCTAGGAAGTAATAGTGAG RNA cleavage Histidine 
pH3DZ2 68 TGGTATAAGGGAGGCTAGAGAGGGTGTGGAAGAGCGGACAAAGGGTGGAT... RNA cleavage
pH3DZ4 68 TTGGGAGGAGGAGACTGATATTTGGTCCTTTTTAGCCGGTGCCGTTTTAG... RNA cleavage
pH3DZ5 70 TGGTGGAGGAAAGAAATAGCTTCGTCTTCCAtCGTGATGAGTGGGGAGGG... RNA cleavage
pH3DZ6 68 CTAGAGTAGCTTTGTGCTGTAAGGCTAGTTTTGGTAAAGATAGGGCTCTA... RNA cleavage
pH3DZ7 68 GTGGTGTGTGATAGGGAGCCAACGAGTGACGAGATAGGTAGCCACGGTTA... RNA cleavage
pH3DZ8 70 GGCAAAAGGAAACGCAGTTTGGGTGGAAACAGGTGGAAGGGTGTCACGAG... RNA cleavage
pH3DZ9 70 GGAAGTTGGAGGGTTCGTATTGCTACGTTGCCTTAGAGAGGTTGTGGAAG... RNA cleavage
pH3DZ11 68 GAAGTGGGGGTCGGGGGAAGGGAGGCACGCGTAAAGGTAGGTGTGAGGGC... RNA cleavage
pH4DZ1 70 TGTATGCTAGCTCGGGGAGAAACATCTTTGCGGGATAAGGCCGCCGATAG... RNA cleavage Mn2+ 
pH4DZ2 70 TGAATAGGGTCCTAGGCATAAATTACGAAAACGGCTTTAATCTTTTAGTG... RNA cleavage
pH4DZ3 70 TGGGTAAAAGGAAAAGATGGCGGAGCGAGTTGATGGCGTGATTAGGAGGA... RNA cleavage
pH4DZ4 68 TGTACGGTAGGGAGGGTGCAAGGTGAATCGGATTAGTTTACGGAAGAGTG... RNA cleavage
pH4DZ5 69 CAGTAGGGCAATTTGGTTGGGTTTAATGTGATACGAAGAACCATATTTGC... RNA cleavage
pH4DZ6 70 GAGGTGGGGGTCGGGGGAAGGGAGGCACGCGTAAAGGTAGGTGTGAGGGC... RNA cleavage
pH4DZ7 70 GAGGTGGGGGTCGGGGGAAGGGAGGCACGCGTAAAGGTAGGTGTGAGGGC... RNA cleavage
pH4DZ8 70 GGGAGTTGGAGGATCCGTACTGTTACGTTGTCTTAGAGAGGGTGTGGAAG... RNA cleavage
pH5DZ1 70 TGAATAGGGTCTCGGGCATAAATTACGGAAACGGTTTTAATTTTCTAGTG... RNA cleavage Mn2+ 
pH5DZ2 69 CTGTGGGAGGCTAAGAGAGGTTGTGGAAGAGCGGTAAACTAATATCAGTG... RNA cleavage
pH5DZ3 69 CGGAGTAGGGGGGGAAGGTTGGGTAAAGGAATTTTTATGCTGTTAGCAGG... RNA cleavage
Clone91 49 TGCAGTCGGGTAGTTAAACCGACCTTCAGACATAGGCAGGCGTATATCT RNA cleavage UO22+ 
pH5DZ4 68 GGCAGAGGAGGTGGGCGATGAGTAGTAGGGGGGGAAGGTTGGGTTCAGTT... RNA cleavage
pH5DZ5 70 GAAGTGGGGGTCGGGGGAAGGGAGGCACGTGTAAAGGTAGGTGTGAGGGT... RNA cleavage
pH5DZ6 70 TCGTAGGGGGGGAAGGTTGGGTGGAAGGAGTTAGTAAGACGATTGTACTA... RNA cleavage
pH6DZ1 70 ATCGGACAAGGGAGGCACTGGAGGTTGAGGTAGTGAGCGTTGGTTAACGC... RNA cleavage Mn2+ 
pH6DZ2 70 TCGTAAGGGGGGAAGGTTGGGTGGAGGGAGTCAGTAAGACGATTGTACTA... RNA cleavage
pH7DZ1 69 GTGGAACCCATGATGAGCCGAGTTGGGGTGTGTCTCTCGTATATGGCGGA... RNA cleavage Mn2+ 
pH7DZ2 70 GTCGGACAAGGGAGGCACTGGGGATTGAGGTAGTGAGCGTTGGTTAACGC... RNA cleavage
pH7DZ3 70 TAACTCATTATGAGGTGACGGAGTACCGGAAGAGGGAGAGATGAAGGGAT... RNA cleavage
pH7DZ4 69 CCCATGATGAGAGTGCTACTCGGAAGAGGGACATGATAGGGGAGGGATTA... RNA cleavage
Dz22_group1 23 CAACCCATTATCGACATTCTCTC RNA cleavage
Dz24_group2 23 GTCCCAACCCCAAACCCTTCTCA RNA cleavage
Dz40_group3 23 TACCCAACCCCAAATCCTTCTCC RNA cleavage
Dz15_group4 23 TTACAAACCCCAAACCTTCTCTT RNA cleavage
Dz42_unclassified 23 CCCAACCCCAAATCCTTCTCTCG RNA cleavage
Dz6_group1 23 CTACCCTCAAGCGACTTCTCTCG RNA cleavage
Dz7_group1 23 CTACCCTCAAGCGACTTCTCTCG RNA cleavage
Dz16_group1 23 CTACCCTCAAGCGACTTCTCTCG RNA cleavage
Dz39_group1 23 CTACCCTCAAGCGACTTCTCTCG RNA cleavage
Dz60_group1 23 CTACCCTCAAGCGACTTCTCTCC RNA cleavage
Dz52_group1 23 TTACCCTTAATCGACTTTCTCTT RNA cleavage
Dz2_group1 23 CAACCCTTTATCGACATTCTCTC RNA cleavage
Dz18_group2 23 GTCCCAACCCCAAATCCTTCTCC RNA cleavage
Dz43_group2 23 GTCCCAACCGCAAACCCTTCTCT RNA cleavage
Dz29_group3 23 TACCCAACCCCAAATCCTTCTCC RNA cleavage
Dz20_group3 23 TACCCAACCCCAAATCCTTCTCC RNA cleavage
Dz13_group3 23 TACCCAACCCCAAATCCTTCTCC RNA cleavage
Dz12_group3 23 TACCCAACCCCAAACCTTTCTTT RNA cleavage
Dz30_group4 23 TACCCAACCCCAAACCTTCTCTT RNA cleavage
Dz38_group4 23 TTACAAACCCCAAACCTTCTCTT RNA cleavage
Dz23_group4 23 TTACAAACCCCAAACCTTCTCTT RNA cleavage
AA07 21 GGGTTCGGTGGAGCGGCGCGA RNA cleavage Mg2+ 
AA14 21 TGGTCTCGCGGTTCCTGGTTA RNA cleavage Mg2+ 
AA17 21 CCTGCAAGGAGGTTTACCGGG RNA cleavage Mg2+ 
AB08 19 GGGAAGCCAGTGGTACGTT RNA cleavage Mg2+ 
Clone74 49 ATTCATCGTGCGTTACACGACTTCAAACGTAGGGAGGCGGCTGGTAGTT RNA cleavage UO22+ 
6SE3 40 CGCTAGATACGTGAATGTGTTTGACAGAGCCGGTCATCAA RNA cleavage Mn2+ Mg2+ Zn2+ 
6SE10 40 CGATAGATAACGGGGTGGATTTGCAACCGCAGTACATATA RNA cleavage Mn2+ Mg2+ Zn2+ 
6SE11 40 GGCTAGAGAAGCGAGTGTGTTTGCTACAACGGGCCGTTAA RNA cleavage Mn2+ Mg2+ Zn2+ 
6SE12 40 CGATAGATACGTAGGAGCGTTAGCTATAGCCGTACATAGA RNA cleavage Mn2+ Mg2+ Zn2+ 
6SE15 40 GGCCATATAACTCGGAGAGTTTCCTAGAGCTGTGCGTGAA RNA cleavage Mn2+ Mg2+ Zn2+ 
6SE22 40 GGCTAGGGAAGCGGCTACGTACACCTCAGCGGGCACATAA RNA cleavage Mn2+ Mg2+ Zn2+ 
6SE30 40 GGCTAGAGAAGCGGATGAGTTTCCTATAGATATCCGGCCA RNA cleavage Mn2+ Mg2+ Zn2+ 
9SE20 40 CGCTAGATAAGTGGGCGCGTTTGCTGTAGTTGTCCTACGA RNA cleavage Mn2+ Mg2+ Zn2+ 
9SE22 40 CGCTAGATAAGTGGATGCGTTTGCTGTAGTTGTCCTTCAA RNA cleavage Mn2+ Mg2+ Zn2+ 
9SE23 40 CGCCAGATAAGTGGAGGCTTTTGCTAGAGTTGTCCTTTAA RNA cleavage Mn2+ Mg2+ Zn2+ 
9SH2 40 CCCTATACAAGTGGGAGGATTAGCCATAGGCGTGGGGCAA RNA cleavage Mn2+ Mg2+ Zn2+ 
9SH3 40 GGCTAGAATAGTGGGGGCGATTGATCTAGGGGGCGCTTAA RNA cleavage Mn2+ Mg2+ Zn2+ 
9SH5 40 CCCTAGATAAGGGGGTGCGTATTCTTTGGGTGCCCCGAAA RNA cleavage Mn2+ Mg2+ Zn2+ 
9SH18 40 AGGCAGAAAAGTGGGTACTCTTGTTAGAGCTCTACATATA RNA cleavage Mn2+ Mg2+ Zn2+ 
9SK1 40 GGAGAGCTCGTGTGTGAGAGCATTAAGTGAACTGACTGGT RNA cleavage Mn2+ Mg2+ Zn2+ 
9SK2 40 TACGGACGGGGCGTAGCGGATTGAACTGCAGAGCAGAGTG RNA cleavage Mn2+ Mg2+ Zn2+ 
9SK5 40 GGGGCAGTAGGAGGTTAGGCCAGGGAGAGAGGAAGGTAGG RNA cleavage Mn2+ Mg2+ Zn2+ 
9SK17 40 GCCAGCGATCAAAGACGGCGAGTTGTACCCATAGGTGTCT RNA cleavage Mn2+ Mg2+ Zn2+ 
9SK29 40 GAGAGTGTACGGTTACGCACTAGCTAACAGGAGTTCGTGC RNA cleavage Mn2+ Mg2+ Zn2+ 
9SK31 40 CCGGGCTGCGAAGTTGGCGATAAGCTACCGTAGGACGCTT RNA cleavage Mn2+ Mg2+ Zn2+ 
9Q1 22 GGAGACAGGTTCCGGATGCATG RNA ligation Mn2+ Mg2+ 
9Q2 22 GGAGATAGGTTCCAGCTGATTG RNA ligation Mn2+ Mg2+ 
9Q5 22 GGACCGATGGAGTGAACTATGC RNA ligation Mn2+ Mg2+ 
9Q9 22 ACGGACAGTTTCCGGAGCCGTG RNA ligation Mn2+ Mg2+ 
9R2a 22 GGTACGGGGCGTGCGGAGGCAC RNA ligation Mn2+ Mg2+ 
9R2b 22 GGTTCGGGGTATGCGGAGGCAT RNA ligation Mn2+ Mg2+ 
9R4a 22 GGACCGATGGAGTGAACTATGC RNA ligation Mn2+ Mg2+ 
9R6 22 GGACCATGTTGGAGCGGCCCAG RNA ligation Mn2+ Mg2+ 
9R7 22 GGACCATGGGGGAGCGGCCCGC RNA ligation Mn2+ Mg2+ 
9R16b 22 GGAGGATCGGACAGCGTTATCG RNA ligation Mn2+ Mg2+ 
9R20 22 GGAGCGACACACAGACCTGTTC RNA ligation Mn2+ Mg2+ 
10Q7b 22 GGAGGATCGTACAGCGTTATCG RNA ligation Mn2+ Mg2+ 
Ag2 6 GGGATT RNA cleavage Ag+ 
Ag3 21 GGGGGGCGGAAGGGCTGCGCT RNA cleavage Ag+ 
Ag4 25 GCGGAACCCACCTACACGGATGGCT RNA cleavage Ag+ 
Ag5 15 GGAACACACCCGGGG RNA cleavage Ag+ 
Ag6 5 GGTGG RNA cleavage Ag+ 
Ag7 50 CATAGCAGAGCGTCTAGAGATGTAAGTAAATCTTTTCTCAGCGAGACGAA RNA cleavage Ag+ 
Ag8 20 GGCGGACTGGGTGGCTGTGG RNA cleavage Ag+ 
Clone33 49 TGCAGTCGGGTAGTTAAACCGACCTTCAGACATAGGCAGGCGTATATCT RNA cleavage UO22+ 
Ag9 49 TAGGCCTTAAACCCGTTGTAGGATTTGTAAGTCATTACTCTGAAGACGT RNA cleavage Ag+ 
Ag10 49 TAGGTGATTTCCACGATAGAGAAACTATTATGCGGAAACAGGGCAGCGT RNA cleavage Ag+ 
Ag11 5 GTCCG RNA cleavage Ag+ 
Ag12 22 GTCAACGACCGGGCCGGAAACT RNA cleavage Ag+ 
Ag13 27 GAGCATGAAGGCTCCATAAGTCGCGGG RNA cleavage Ag+ 
Ag14 50 TTAGAACTTAAATTCACGTAGCGCCAAGGGGTGATATGAGGCGACCGTGT RNA cleavage Ag+ 
Ag15 23 GCGGTTAATTGAGTCGCACCGAC RNA cleavage Ag+ 
Ag16 6 ACCGAC RNA cleavage Ag+ 
Ag17 21 GCACGGGGCGACATGTGGATT RNA cleavage Ag+ 
Ag18 21 TGGCGTCACAGGATCGCGGTT RNA cleavage Ag+ 
Ag10c 38 TAGGTGATTTCCACGATTATGCGGAAACAGGGCAGCGT RNA cleavage Ag+ 
12BB33 40 TGTAGCCTTCTGAAGGTTGGCTGGTTCGGCGAGGTGGGAA RNA ligation Zn2+ 
10-18 57 CTAACCATTATCCTCGATTGTTAGAGCGAACAGCTGCAACGGGTTGATTA... RNA ligation Mg2+ 
7Q5 19 TTTGTGGAGGTAAGCTCTG RNA ligation Mg2+ 
6CA30 40 CCCGTACGCTGCCATGGCGCCATTCTGGCACGTAGTGTTG RNA ligation Mn2+ 
6BX42 40 GCAGTGCTAATGAGGTATCGCAAATAAGTGCGCAGCCGAA RNA ligation Mn2+ 
7P4 20 TTCGGTGGAGGTAAGCTCTG RNA ligation Mg2+ 
7Q2 20 TTCTGCGCAGGTAAGCTGTA RNA ligation Mg2+ 
7Z48 40 ACGGGGCCGGTTTGCGTGCCTGATTGGGAGGTTAGCTCTA RNA ligation Mg2+ 
9A12 40 CTTTACGGTAGGGTGCCTGTGATAATGATCAGGGGACGGC RNA ligation Mg2+ 
9A2 40 TGCGTTCTGATGAATTGCACATAGCTTATAGTTCCTTGCT RNA ligation Mg2+ 
9F18 40 GGGATGTGGGGCGCCACCAAGTTAATGTTTGGTTTGGGGA RNA ligation Mn2+ Mg2+ 
7DE5 40 GTAGGGTTGGTAGACCAGGTTGAGCCGGCGTCCTTGTTTA RNA ligation Zn2+ 
8CW8 40 TACAAGGTGGGAGGAGGGAGCACCGATGCGGCATATCGTG RNA ligation Zn2+ 
12BB1 40 CCGCTCCGATTGGTGGAGTCTATTGGGGCCTGTAGGCGAG RNA ligation Zn2+ 
8CW13 40 GGGGAAGACAAGATAGTCGAGGGGGACGCGCTCTCAGCCT RNA ligation Zn2+ 
12BB5 40 CAGCGCGATTGAGTGCGTGATTGAAGCTCGGGGTTGGTTA RNA ligation Zn2+ 
12BB8 39 CACGCTGACTAGCTTCGTGAGGGGGTGTGATAGATGCGG RNA ligation Zn2+ 
6J2 40 TGCACGGGGGGTGAGGTTTCCGCCGTTGAAACGTAGCACG RNA ligation Zn2+ 
8LX1 50 GACGCCACCGAAGTCGCCATCTCCCGTAGGTGAAGGGCGTGAGGGTTCCA RNA ligation Mn2+ 
8LX6 50 CAGTGCAGGGCGTGAGGGCTCCATCCCCAGTGCAGGGCGTGAGGGCTCGG RNA ligation Mn2+ 
10-20 57 CTACCCATTATTCACGAATGATAGCACGAATAGTGTGAACGGGTTGATTA... RNA ligation Mg2+ 
10DM10 31 CCTGTGGCAAAGGGCGTGAGGGTACTGTTCC RNA ligation Mg2+ 
7DM12 31 CATTATGCCCAGGGCGTGAGGGTGCGGTTCC RNA ligation Mg2+ 
8BH41 39 AGGGACAAACCATAAGTCGCATCGGGTGGAACGTAGACC RNA ligation Mg2+ 
G5_1 50 TCACACATCTCTGAAGTAGCGCCGCCGTATGTGACGCTAGGGGTTCGCCT RNA cleavage Pb2+ 
G5_7 50 TCTGCTCTCCTCTATTCTAGCAGTGCAGCGAAATATGTCGAATAGTCGGT RNA cleavage Pb2+ 
G5_8 50 TTGCCCAGCATAGTCGGCAGACGTGGTGTTAGCGACACGATAGGCCCGGT RNA cleavage Pb2+ 
Mg5 (class 2) 74 AGCACGCATGACTTTGATGCCACGTAAAGTGAAAGAGCTGTTGATCTGTC... RNA cleavage Ca2+ 
class 14_sel_b 64 GTGGGCGGAGTTTACCCAAGAAGGGGTGGAGACGCGTCCTTGAGTAGGGT... RNA cleavage
class 19_sel_c 73 TAGCAGGGGGGGAAAAAAGTCTATCGCGTAATAGATACGACGACTGTCTG... RNA cleavage
17-E 15 TCCGAGCCGGTCGAA RNA cleavage Zn2+ 
Clone79 49 ATTCATCGTGCGTTACACGACTTCAAACGTAGGGAGGCGGCTGGTAGTT RNA cleavage UO22+ 
Na24 43 TTTACCCAAGAAGGGGTGCAACCATTGCCTAACCTAATCACCG RNA cleavage
9HR17 49 CAGCTATATGTGCTGGACTGAGAGGGGTAGTTTCGCAGTGAGGTGTAGG RNA ligation Mg2+ 
pH3DZ3 70 GAGGTGAACAAGCGGCTGAGCTTTTGGAAGAAGGCATAAGGAAAAGGTTA... RNA cleavage
pH3DZ10 70 TGAATGAAACCTCGGGCATAAATTACGGAAACGGCTTTAATTTTTTAGTG... RNA cleavage
pH6DZ3 69 GAGTGGGGGTCGGGGGAAGGGAGGCATGCGTAAAGGTAGGTGCGAGGGTG... RNA cleavage
Dz27_group1 23 CTACCCTCAAGCGACTTCTCTCG RNA cleavage
Dz49_group1 23 CTACCCTCAAGCGACTTCTCTCG RNA cleavage
AC17 20 GGGTCTCCAGCCGGACGTTA RNA cleavage Mg2+ 
Clone51 49 TGCAGTCGGGTAGTTAAACCGACCTTCAGACATAGGCAGGCGTATGTCT RNA cleavage UO22+ 
6SE20 40 GGCTAGAGCAGCGGGTGTGTTTGCTATACCCGGCCCTATA RNA cleavage Mn2+ Mg2+ Zn2+ 
9SE33 40 CGCCAGATAAGTGGAGACTTTTGCTATAGTTGTCCTTGTA RNA cleavage Mn2+ Mg2+ Zn2+ 
9SH25 40 CGCCCGTTGGCAGGGTGCGCTTGTTATCGTTGTCCTGCAG RNA cleavage Mn2+ Mg2+ Zn2+ 
Ag1 21 AACGCGCACGGCGGAACCCAC RNA cleavage Ag+ 
Ag19 25 CGGCGAGATGTGTAGGCCGGGATTT RNA cleavage Ag+ 
Clone53 49 TTTATTGGATACCACTCCAACTTCAAACATACAGAATCGCTGAGTCTCC RNA cleavage UO22+ 
9DB1 40 GGATCATACGGTCGGAGGGGTTTGCCGTGAACATTCTTCA RNA ligation Mg2+ 
Lu12 99 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTTA... RNA cleavage Nd3+ 
Lu2 101 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTTA... RNA cleavage Lu3+ 
Lu7 100 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTCR... RNA cleavage Lu3+ 
Lu29 (identical to Lu2) 101 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTTA... RNA cleavage Lu3+ 
Lu17 (identical to Lu2) 101 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTTA... RNA cleavage Lu3+ 
Lu1 99 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTTA... RNA cleavage Lu3+ 
Lu27 101 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTTA... RNA cleavage Lu3+ 
Lu30 101 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTTA... RNA cleavage Lu3+ 
Lu31 99 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTTA... RNA cleavage Lu3+ 
Lu11 100 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTTA... RNA cleavage Lu3+ 
Lu32 100 CTGTAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTTA... RNA cleavage Lu3+ 
Lu40 (identical to Lu8) 100 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTTA... RNA cleavage Lu3+ 
Lu39 (identical to Lu8) 100 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTTA... RNA cleavage Lu3+ 
Lu35 (identical to Lu8) 100 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTTA... RNA cleavage Lu3+ 
Lu28 (identical to Lu8) 100 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTTA... RNA cleavage Lu3+ 
Lu21 (identical to Lu8) 100 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTTA... RNA cleavage Lu3+ 
Clone44 51 CGTATGCCGGACATAATCGAGAAGGTGAATCGTGTAATGTATTTGTCCCC... RNA cleavage UO22+ 
Clone48 51 CGTATGCCGGACATAATCGAGAAGGTGAATCGTGTAATGTATTTGTCCCC... RNA cleavage UO22+ 
Clone63 49 TACATCGACTGCCGGCAGACAGGCGACTTCAAATATGAGTGAGACATAG RNA cleavage UO22+ 
Lu20 (identical to Lu8) 100 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTTA... RNA cleavage Lu3+ 
Lu13 (identical to Lu8) 100 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTTA... RNA cleavage Lu3+ 
Lu8 100 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTTA... RNA cleavage Lu3+ 
Lu14 99 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTTA... RNA cleavage Lu3+ 
Lu9 100 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTTA... RNA cleavage Lu3+ 
Lu37 100 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTTA... RNA cleavage Lu3+ 
Lu18 100 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTCTA... RNA cleavage Lu3+ 
Lu22 100 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTTA... RNA cleavage Lu3+ 
Lu34 (identical to Lu22) 100 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTTA... RNA cleavage Lu3+ 
Lu24 100 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTTA... RNA cleavage Lu3+ 
Lu4 100 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTTA... RNA cleavage Lu3+ 
Lu5 100 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTTA... RNA cleavage Lu3+ 
Lu36 99 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTTA... RNA cleavage Lu3+ 
Lu16 100 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACAAAAATG... RNA cleavage Lu3+ 
Lu23 (identical to Lu16) 100 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACAAAAATG... RNA cleavage Lu3+ 
Lu25 99 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTTA... RNA cleavage Lu3+ 
Lu38 (identical to Lu12) 99 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTTA... RNA cleavage Lu3+ 
Clone45 48 TACATCGACTGCCGGCAGACAGGCGACTTAAATATGAGTGAGACATAG RNA cleavage UO22+ 
Clone47 50 CAGACGCCATAATCGGCGTACCGGTCGGAGTGCAACAATGACTAACGTTG RNA cleavage UO22+ 
Clone46 51 CAGACGCCATAATCGGCGTACCGGTCGGAAGTGCAACAATGACTAGCGTT... RNA cleavage UO22+ 
Clone14 49 TACAGTACCACAACGTGTACCTTCAARCACAGGGATCGGGAATACATCG RNA cleavage UO22+ 
Clone93 49 TACAGTACCACAACGTGTACCTTCARACACAGGGATCGGGAATACATCG RNA cleavage UO22+ 
Lu15 (identical to Lu12) 99 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTTA... RNA cleavage Lu3+ 
Lu6 99 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTTA... RNA cleavage Lu3+ 
Lu33 100 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTTA... RNA cleavage Lu3+ 
Lu26 99 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTTA... RNA cleavage Lu3+ 
Lu10 99 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTTA... RNA cleavage Lu3+ 
Lu1a 51 TTTCGCCATCTTTACAAGGAAGGATGCACAACGGTTATAGTGACTCGTGA... RNA cleavage Ce3+ 
Lu1b 46 TTTCGCCATCTTTACAAGGAACACAACGGTTATAGTGACTCGTGAC RNA cleavage Ce3+ 
Lu1c 51 TTTCGCCATCTTTACAAGAAAAAAAAAAAAACGGTTATAGTGACTCGTGA... RNA cleavage Ce3+ 
Lu1d 51 TTTCGCCATCTTTACAAGTTTTTTTTTTTTTCGGTTATAGTGACTCGTGA... RNA cleavage Ce3+ 
Lu1e 51 TTTCGCCATCTTTACAAGCCCCCCCCCCCCCCGGTTATAGTGACTCGTGA... RNA cleavage Ce3+ 
NaA43 109 GTTCAGACTAATCATCACGTATAGGAAGTACCGCATGGTACCAGGTCAAA... RNA cleavage Na+ 
A44 109 GTTCAGACTAATCATCACGTATAGGAAGTACCGCATGGTACCGGGATAGG... RNA cleavage Na+ 
A28 109 GTTCAGACTAATCATCACGTATAGGAAGTACCGCATGGTACCGGGATAGG... RNA cleavage Na+ 
A49 110 GTTCAGACTAATCATCACGTATAGGAAGTACCGCATGGTACCGGGGATAG... RNA cleavage Na+ 
A27 110 GTTCAGACTAATCATCACGTATAGGAAGTACCGCATGGTACCGGGGATAG... RNA cleavage Na+ 
A47 110 GTTCAGACTAACCATCACGTATAGGAAGTACCGCATGGTACCCGGTAAAA... RNA cleavage Na+ 
A35 110 GTTCAGACTAATCATCACGTATAGGAAGTACCGCATGGCCCCCGGTAAAA... RNA cleavage Na+ 
A33 110 GTTCAGACTAATCATCACGTATAGGAAGTACCGCATGGTACCCGGTAAAA... RNA cleavage Na+ 
A40 110 GTTCAGACTAATCATCACGTATAGGAAGTACCGCATGGTACCCAGTAAAA... RNA cleavage Na+ 
A48 111 GTTCAGACTAATCATCACGTATAGGAAGTACCGCATGGTACCCGGTAAAA... RNA cleavage Na+ 
A50 113 GTTCAGACTAATCATCACGTATAGGAAGTACCGCATGGTACCCGGTAAAA... RNA cleavage Na+ 
Clone65 51 CAGACGCCATAATCGGCGTACCGGTCGGAAGTGCAACAATGACTAACGTT... RNA cleavage UO22+ 
Clone84 51 CAGACGCCATAATCGGCGTACCGGTCGGAAGTGCAACAATGACTAACGTT... RNA cleavage UO22+ 
Clone18 51 CAGACGCCATAATCGGCGTACCGGTCGGAAGTGCAACAATGACTAACGTT... RNA cleavage UO22+ 
S3 20 AAATCCAGGGTTGGCCGACA RNA cleavage Mn2+ 
A5 110 GTTCAGACTAATCATCACGTATAGGAAGTACCGCATGGTACCCGGTAAAA... RNA cleavage Na+ 
A13 (Identical to A5) 110 GTTCAGACTAATCATCACGTATAGGAAGTACCGCATGGTACCCGGTAAAA... RNA cleavage Na+ 
A16 (Identical to A50) 113 GTTCAGACTAATCATCACGTATAGGAAGTACCGCATGGTACCCGGTAAAA... RNA cleavage Na+ 
A23 (Identical to A5) 110 GTTCAGACTAATCATCACGTATAGGAAGTACCGCATGGTACCCGGTAAAA... RNA cleavage Na+ 
A25 (Identical to A5) 110 GTTCAGACTAATCATCACGTATAGGAAGTACCGCATGGTACCCGGTAAAA... RNA cleavage Na+ 
A26 (Identical to A50) 113 GTTCAGACTAATCATCACGTATAGGAAGTACCGCATGGTACCCGGTAAAA... RNA cleavage Na+ 
A34 (Identical to A5) 110 GTTCAGACTAATCATCACGTATAGGAAGTACCGCATGGTACCCGGTAAAA... RNA cleavage Na+ 
A37 (Identical to A48) 111 GTTCAGACTAATCATCACGTATAGGAAGTACCGCATGGTACCCGGTAAAA... RNA cleavage Na+ 
A39 (Identical to A5) 110 GTTCAGACTAATCATCACGTATAGGAAGTACCGCATGGTACCCGGTAAAA... RNA cleavage Na+ 
A12 110 GTTCAGACTAATCATCACGTATAGGAAGTACCGCATGGTACCCGGTAAAA... RNA cleavage Na+ 
A21 110 GTTCAGACTAATCATCACGTATAGGAAGTACCGCATGGTACCCGGTAAAA... RNA cleavage Na+ 
A2 110 GTTCAGACTAATCATCACGTATAGGAAGTACCGCATGGTACCAGGTGGAA... RNA cleavage Na+ 
A31 (Identical to A2) 110 GTTCAGACTAATCATCACGTATAGGAAGTACCGCATGGTACCAGGTGGAA... RNA cleavage Na+ 
A11 110 GTTCAGACTAATCATCACGTATAGGAAGTACCGCATGGTACAGGTCAAAG... RNA cleavage Na+ 
A4 (Identical to NaA43) 109 GTTCAGACTAATCATCACGTATAGGAAGTACCGCATGGTACCAGGTCAAA... RNA cleavage Na+ 
A30 111 CTTCACACTAATCATCACCTATACCAACTACCCCATZCTACCACCTCAAA... RNA cleavage Na+ 
A32 109 GTTCAGACTAATCATCACGTATAGGAAGTACCGCATGGTACCAGGTCAAA... RNA cleavage Na+ 
A14 109 GTTCAGACTAATCATCACGTATAGGAAGTACCGCATGGTACCAGGTCAAA... RNA cleavage Na+ 
A45 108 GTTCAGACTAATCATCACGTATAGGAAGTACCGCATGGTACAGGTCAAAG... RNA cleavage Na+ 
A3 108 GTTCAGACTAATCATCACGTATAGGAAGTACCGCATGGTACAGGTCAAAG... RNA cleavage Na+ 
S22 19 CAGGTAGGGGTCCCGGTCA RNA cleavage Mn2+ 
Clone73 49 TACAGTACCACAACGTGTACCTTCARACACAGGGATCGGGAATACATCG RNA cleavage UO22+ 
A17 108 GTTCAGACTAATCATCACGTATAGGAAGTACCGCATGGTACAGGTCAAAG... RNA cleavage Na+ 
A7 110 GTTCAGACTAATCATCACGTATAGGAAGTACCGCATGGTACGGGGTCAAA... RNA cleavage Na+ 
A10 109 GTTCAGACTAATCATCACGTATAGGAAGTACCGCATGGTACAGGTCAAAG... RNA cleavage Na+ 
A19 109 GTTCAGACTAATCATCACGTATAGGAAGTACCGCATGGTACAGGTCAAAG... RNA cleavage Na+ 
A36 109 GTTCAGACTAATCATCACGTATAGGAAGTACCGCATGGTACGTGGTCAAA... RNA cleavage Na+ 
A15 108 GTTCAGACTAATCATCACGTATAGGAAGTACCGCATGGTACAGGTCAAAG... RNA cleavage Na+ 
A46 (Identical to A15) 108 GTTCAGACTAATCATCACGTATAGGAAGTACCGCATGGTACAGGTCAAAG... RNA cleavage Na+ 
A22 109 GTTCAGACTAATCATCACGTATAGGAAGTACCGCATGGTACTAGGTCAAA... RNA cleavage Na+ 
A18 (Identical to A15) 108 GTTCAGACTAATCATCACGTATAGGAAGTACCGCATGGTACAGGTCAAAG... RNA cleavage Na+ 
A1 (Identical to A15) 108 GTTCAGACTAATCATCACGTATAGGAAGTACCGCATGGTACAGGTCAAAG... RNA cleavage Na+ 
A24 110 GTTCAGACTAATCATCACGTATAGGAAGTACCGCATGGTACCAGGTCAAA... RNA cleavage Na+ 
A29 (Identical to A24) 110 GTTCAGACTAATCATCACGTATAGGAAGTACCGCATGGTACCAGGTCAAA... RNA cleavage Na+ 
A20 (Identical to A15) 108 GTTCAGACTAATCATCACGTATAGGAAGTACCGCATGGTACAGGTCAAAG... RNA cleavage Na+ 
A41 109 GTTCAGACTAATCATCACGTATAGGAAGTACCGCATGGTACGCGGTCAAA... RNA cleavage Na+ 
A8 109 GTTCAGACTAATCATCACGTATAGGAAGTACCGCATGGTACGCGGTCAAA... RNA cleavage Na+ 
B42 110 GTTCAGACTAATCATCACGTATAGGAAGTACCGCATGGTACAGGTCAAAG... RNA cleavage Na+ 
B48 113 GTTCAGACTAATCATCACGTATAGGAAGTACCGCATGGTAC—AGGTCAAA... RNA cleavage Na+ 
B22 (Identical to A11) 110 GTTCAGACTAATCATCACGTATAGGAAGTACCGCATGGTACAGGTCAAAG... RNA cleavage Na+ 
B36 110 GTTCAGACTAATCATCACGTATAGGAAGTACCGCATGGTACAGGTCAAAG... RNA cleavage Na+ 
B45 110 GTTCAGACTAATCATCACGTATAGGAAGTACCGCATGGTACGCGGTCAAA... RNA cleavage Na+ 
S23 20 GGGTTCATCAAGGGGTATGG RNA cleavage Mn2+ 
B13 109 GTTCAGACTAATCATCACGTATAGGAAGTACCGCATGGTACAGGTCAAAG... RNA cleavage Na+ 
B49 (Identical to B45) 110 GTTCAGACTAATCATCACGTATAGGAAGTACCGCATGGTACGCGGTCAAA... RNA cleavage Na+ 
B7 (Identical to B45) 110 GTTCAGACTAATCATCACGTATAGGAAGTACCGCATGGTACGCGGTCAAA... RNA cleavage Na+ 
B9 (Identical to B45) 110 GTTCAGACTAATCATCACGTATAGGAAGTACCGCATGGTACGCGGTCAAA... RNA cleavage Na+ 
B25 (Identical to B45) 110 GTTCAGACTAATCATCACGTATAGGAAGTACCGCATGGTACGCGGTCAAA... RNA cleavage Na+ 
B47 110 GTTCAGACTAATCATCACGTATAGGAAGTACCGCATGGTACTTGACCCAA... RNA cleavage Na+ 
B35 110 GTTCAGACTAATCATCACGTATAGGAAGTACCGCATGGCACTTGACCCAA... RNA cleavage Na+ 
B46 109 GTTCAGACTAATCATCACGTATAGGAAGTACCGCATGGTACCAGGTCAAA... RNA cleavage Na+ 
B38 109 GTTCAGACTAATCATCACGTATAGGAAGTACCGCATGGTACAAGGTCAAA... RNA cleavage Na+ 
B5 110 GTTCAGACTAATCATCACGTATAGGAAGTACCGCATGGTACAGGTCAAAG... RNA cleavage Na+ 
B23 112 GTTCAGACTAATCATCACGTATAGGAAGTACCGCATGGTAC—AGGTCAAA... RNA cleavage Na+ 
B24 109 GTTCAGACTAATCATCACGTATAGGAGTACCGCATGGTACCAGGTCAAAG... RNA cleavage Na+ 
B15 110 GTTCAGACTAATCATCBCGTATAGGAAGTACCGCATGGTACCGGGGATAG... RNA cleavage Na+ 
B33 111 GTTCAGACTAATCATCACGTATAGGAAGTACCGCATGGTAC—CGGGGATA... RNA cleavage Na+ 
B4 109 GTTCAGACTAATCATCACGTATAGGAAGTACCGCATGGTACCAGGTCAAA... RNA cleavage Na+ 
B12 (Identical to B4) 109 GTTCAGACTAATCATCACGTATAGGAAGTACCGCATGGTACCAGGTCAAA... RNA cleavage Na+ 
B11 (Identical to NaA43) 109 GTTCAGACTAATCATCACGTATAGGAAGTACCGCATGGTACCAGGTCAAA... RNA cleavage Na+ 
B21 109 GTTCAGACTAATCATCACGTATAGGAAGTACCGCATGGTACCAGGTCAAA... RNA cleavage Na+ 
B3 110 GTTCAGACTAATCATCACGTATAGGAAGTACCGCATGGTACTAGGTCAAA... RNA cleavage Na+ 
B31 111 GTTCAGACTAATCATCACGTATAGGAAGTACCGCATGGTACTAGGTCAAA... RNA cleavage Na+ 
B19 111 GTTCAGACTAATCATCACGTATAGGAAGTACCGCATGGTACCAGGTCAAA... RNA cleavage Na+ 
S9 20 TACTGCTTTACTGGCGGCCA RNA cleavage Mn2+ 
NaA43E 61 GCGGCGGTACCAGGTCAAAGGTGGGTGAGGGGACGCCAAGAGTCCCCGCG... RNA cleavage Na+ 
B30 108 GTTCAGACTAATCATCACGTATAGGAAGACCGCATGGTACAGGTCAAAGG... RNA cleavage Na+ 
B40 110 GTTCAGACTAATCATCACGTATAGGAAGTACCGCATGGTACTAGGTCAAA... RNA cleavage Na+ 
B17 109 GTTCAGACTAATCATCACGTATAGGAAGTACCGCATGGTACGCGGTCAAA... RNA cleavage Na+ 
B27 110 GTTCAGACTAATCATCACGTATAGGAAGTACCGCATAGTACGTGGTCAAA... RNA cleavage Na+ 
B6 109 GTTCAGACTAATCATCACGTATAGGAAGTACCGCATGGTACAGGTCAAAG... RNA cleavage Na+ 
B10 (Identical to B6) 109 GTTCAGACTAATCATCACGTATAGGAAGTACCGCATGGTACAGGTCAAAG... RNA cleavage Na+ 
B43 110 GTTCAGACTAATCATCACGTATAGGAAGTACCGCATGGTACGTGGTCAAA... RNA cleavage Na+ 
B44 (Identical to B43) 110 GTTCAGACTAATCATCACGTATAGGAAGTACCGCATGGTACGTGGTCAAA... RNA cleavage Na+ 
B2 (Identical to B43) 110 GTTCAGACTAATCATCACGTATAGGAAGTACCGCATGGTACGTGGTCAAA... RNA cleavage Na+ 
B16 (Identical to B43) 110 GTTCAGACTAATCATCACGTATAGGAAGTACCGCATGGTACGTGGTCAAA... RNA cleavage Na+ 
B18 112 GTTCAGACTAATCATCACGTATAGGAAGTACCGCATGGTACGTGGTCAAA... RNA cleavage Na+ 
B20 (Identical to B43) 110 GTTCAGACTAATCATCACGTATAGGAAGTACCGCATGGTACGTGGTCAAA... RNA cleavage Na+ 
B26 (Identical to B43) 110 GTTCAGACTAATCATCACGTATAGGAAGTACCGCATGGTACGTGGTCAAA... RNA cleavage Na+ 
B34 (Identical to B43) 110 GTTCAGACTAATCATCACGTATAGGAAGTACCGCATGGTACGTGGTCAAA... RNA cleavage Na+ 
B41 (Identical to B6) 109 GTTCAGACTAATCATCACGTATAGGAAGTACCGCATGGTACAGGTCAAAG... RNA cleavage Na+ 
B29 110 GTTCAGACTAATCATCACGTATAGGAAGTACCGCATGGTACTAGGTCAAA... RNA cleavage Na+ 
B50 (Identical to B6) 109 GTTCAGACTAATCATCACGTATAGGAAGTACCGCATGGTACAGGTCAAAG... RNA cleavage Na+ 
B8 110 GTTCAGACTAATCATCACGTATAGGAAGTACCGCATGGTACCAGGTCAAA... RNA cleavage Na+ 
B14 (Identical to B8) 110 GTTCAGACTAATCATCACGTATAGGAAGTACCGCATGGTACCAGGTCAAA... RNA cleavage Na+ 
S13 20 GGACAAGAGAAAGAGGTTGA RNA cleavage Mn2+ 
B28 (Identical to B8) 110 GTTCAGACTAATCATCACGTATAGGAAGTACCGCATGGTACCAGGTCAAA... RNA cleavage Na+ 
Clone23 49 TACAGTACCACAACGTGTACCTTCAAACACAGGGATCGGGAATACATCG RNA cleavage UO22+ 
DEC22-18 109 GATGTGTCCGTGCFAQGGTTCGATTCTTGATCGTTGTCATTGGCACACGG... RNA cleavage Co2+ 
DET22-18 58 AAGAATCGTTGTCATTGGCACACGGAGGTTTACTGAGTGGTAACCACGTT... RNA cleavage Co2+ 
10-3 36 CACAGUGUGUGAGGCACUGUACGGUGAGUGGUGCUU RNA cleavage Hg2+ 
10-5 37 UUCUCAUCCGUAGUGAGGGACGCGGCGCUCCCCCGUU RNA cleavage Hg2+ 
10-8 37 CAUAGUGCGUGAGGCCCGCCCACUCCCCGUCGUGGUA RNA cleavage Hg2+ 
10-9 37 UUCUCAUCCGUAGUGAGGGACGCGGCGCUCCCCCGUU RNA cleavage Hg2+ 
10-10 37 GCACAGUGUGUGAGGCAUGUGCGAGUGUGCUGUCUCG RNA cleavage Hg2+ 
10-13 39 CACACGUGUGUGACGGCCUCGCGCGCCCGCCCUGCCGUA RNA cleavage Hg2+ 
10-17 37 CAUAGUGCGUGAGGCGCGUCUGCAGCGUGGUGGGUUU RNA cleavage Hg2+ 
10-21 37 CACAGUUGUGUGAUGGCUGGGCAGCCAGCGGUGGUCA RNA cleavage Hg2+ 
Clone22 51 CAGACGCCATAATCGGCGTACCGGTCGGAAGTGCAACAATGACTAACGTT... RNA cleavage UO22+ 
Clone12 51 CAGACGCCATAATCGGCGTACCGGTCGGAAGTGCAACAATGACTAACGTT... RNA cleavage UO22+ 
Clone9 51 CAGACGCCATAATCGGCGTACCGGTCGGACGTGCAACAATGACTAACGTT... RNA cleavage UO22+ 
10-24 33 CAUAGUGCGUGAGGCUUGCGCUGUCAGCGGUCG RNA cleavage Hg2+ 
Clone39 49 TGCAGTCGGGTAGTTARACCGACCTTCAGACATAGGCAGGCGTATATCT RNA cleavage UO22+ 
Clone70 49 TGCAGTCGGGTAGTTAAACCGACCTTCAGACATAGGCAGGCGTATATCT RNA cleavage UO22+ 
10-31 38 CACAGUUGUGUGAGGCGCGUGUACAGUGCGGCGGGUCU RNA cleavage Hg2+ 
10-34 38 CACAGUUGUGUGAUGGCUGGCUCUGCAGCCCGCUGGGU RNA cleavage Hg2+ 
10-40 38 CACACGUGUGUGAGGCAUGCGCUCACUGCCGUGGGUCU RNA cleavage Hg2+ 
10-41 37 CACAGUGUGUGAGGUUCGCCUCUGCCUCCCUGCUACA RNA cleavage Hg2+ 
10-42 36 CAUAGUGCGUGAGGCACGGUUACCGCCGUGGUGUGU RNA cleavage Hg2+ 
10-49 38 CACAGUGUGUGAGGCGUGCGCGAGUGGUUAGUGUCCUG RNA cleavage Hg2+ 
Clone4 49 TACAGCACACAGTGCCTTCAGACAGAGGGAACGTAGAGATTGGCCCCGA RNA cleavage UO22+ 
Clone17 49 TACAGCACACAGTGCCTTCAGACAGAGGGAACGTAGAGATTGGCCCCGA RNA cleavage UO22+ 
Clone5 51 TTCATCGTGGCACACGACCACCAAAACATACGTCCTCAGGAATTGTCCCC... RNA cleavage UO22+ 
Clone30 51 TTCATCGTGGCACACGACCACCAAAACATACGTCCTCAGGAATTGTCCCC... RNA cleavage UO22+ 
Clone49 51 TTCATCGTGGCACACGACCACCAAAACATACGTCCTCAGGAATTGTCCCC... RNA cleavage UO22+ 
Clone43 51 CTCATCGTGGCACACGACCACCAAAACATACGTCCTCAGGAATTGTCCCC... RNA cleavage UO22+ 
Clone41 51 TTCATCGTGGCACACGACCACCAAAACATACGTCCTCAGGAATTGTCCCC... RNA cleavage UO22+ 
Clone82 52 GTCACTCACARAGGGAGCTTCARACATAGTGGTCAAAGTCGTTGTCGCTC... RNA cleavage UO22+ 
Clone7 49 TGCATGCGGAGCACTTCAGATATAGTTCGATGGCGGTGCAGACCAATCC RNA cleavage UO22+ 
Clone61 49 TGCATGCGGAGCACTTCAGATATAGTTCGATGGCGGTGCAGACCAATCC RNA cleavage UO22+ 
Clone36 49 TACATCTAGGAGTAGACTTCARACATAGGATGTCGTGGAGGACGTGTAC RNA cleavage UO22+ 
Clone80 49 TACATCTAGGAGTAGACTTCARACATAGGATGTCGTGGAGGACGTGTAC RNA cleavage UO22+ 
Clone16 49 TGCATCCATAATATATCCATGTAGTAGGGACCTCGAACTACGTGTGAGC RNA cleavage UO22+ 
Clone20 49 TGCATCCATAATATATCCATGTAGTAGGGACCTCGAACTACGTGTGAGC RNA cleavage UO22+ 
Clone29 49 TGCATCCATAATATATCCATGTAGTAGGGACCTCGAACTACGTGTGAGC RNA cleavage UO22+ 
Clone42 49 TGCATCCATAATATATCCATGTAGTAGGGACCTCGAACTACGTGTGAGC RNA cleavage UO22+ 
Clone68 49 TGCATCCATAATATATCCATGTAGTAGGGACCTCGAACTACGTGTGAGC RNA cleavage UO22+ 
Clone71 49 TGCATCCATAATATATCCATGCAGTAGGGACCTCGAACTACGTGTGAGC RNA cleavage UO22+ 
Clone62 49 ATCATACACCACGTAGCTACAAAAGTGGTGGACTTCAAACATAGGGCCC RNA cleavage UO22+ 
Clone66 49 ATCATACACCACGTAGCTACAAAAGTGGTGGACTTCAAACATAGGGCCC RNA cleavage UO22+ 
Clone19 49 ATCATACACCACGTAGCTACARAAGTGGTGGACTTCARACATAGGGCCC RNA cleavage UO22+ 
Clone59 48 ATCATACACCACGTAGCTACARAAGTGGTGACTTCARACATAGGGCCC RNA cleavage UO22+ 
Clone69 49 ATCATACACCACGTAGCTACAAAAGTGGTGGACTTCARACATAGGGCCC RNA cleavage UO22+ 
Clone75 48 CTCATTGCTTATGCAACCCCTAACATAGCGGTAGATCCCTCAATGTCC RNA cleavage UO22+ 
Clone72 49 TTTATTGGATGCCATTCCAACTTCAAACATACAGAATCGCTGAGTCTCC RNA cleavage UO22+ 
Clone26 49 TTTATTGGATACCATTCCAACTTCAAACATACAGAATCGCTGAGTCTCC RNA cleavage UO22+ 
Clone13 49 TTTATTGGATACCATTCCAACTTCAAACATACAGAATCGCTGAGTCTCC RNA cleavage UO22+ 
S19 20 TTGGGGGGGAGAGGTGGGGA RNA cleavage Mn2+ 
Clone2 49 ATTCATCGTGCGTTACACGACTTCARACGTAGGGAGGCGGCTGGTAGTT RNA cleavage UO22+ 
Clone35 49 ATTCATCGTGCGTTACACGACTTCAAACGTAGGGAGGCGGCTGGTAGTT RNA cleavage UO22+ 
S15 20 AGTATATCAAGTGAATGGCA RNA cleavage Mn2+ 
Clone78 49 TGCAGTCGGGTAGTTAAACCGACCTTCAGACATAGGCAGGCGTATATCT RNA cleavage UO22+ 
Clone81 49 TACAGTACCACAACGTGTACCTTCAAACACAGGGATCGGGAATACATCG RNA cleavage UO22+ 
Clone52 49 TACAGTACCACAACGTGTACCTTCAAACACAGGGATCGGGAATACATCG RNA cleavage UO22+ 
Clone38 49 TACAGTACCACAACGTGTACCTTCAAACACAGGGATCGGGAATACATCG RNA cleavage UO22+ 
Clone54 49 TACAGCTANCACAACGTGTACCTTCARACCAGGGATCGGGAATACATCG RNA cleavage UO22+ 
Clone28 49 TGCAGTGCCTGAAAGGCATCCTACCAACATAGTAAGTACTCAGACCGCT RNA cleavage UO22+ 
Clone34 49 TGCAGTGCCTGAAAGGCATCCTACCAACATAGTAAGTACTCAGACCGCT RNA cleavage UO22+ 
Clone89 49 TGCAGTGCCTGAAAGGCATCCTACCAACATAGTAAGTACTCAGACCGCT RNA cleavage UO22+ 
Clone86 49 TGCAGTGCCTGARAGGCATCCTACCAACATAGTAAGTACTCAGACCGCT RNA cleavage UO22+ 
Clone50 48 TGCAGTGCCTGAAAGGCATCCTACCAACAAGTAAGTACTCAGACCGCT RNA cleavage UO22+ 
Clone55 48 TGCAGTGCCTGAAAGGCATCCTACCAACAAGTAAGTACTCAGACCGCT RNA cleavage UO22+ 
Clone57 48 TGCAGTGCCCGAAAGGCATCCTACCAACAAGTAAGTACTCAGGCCGCT RNA cleavage UO22+ 
Clone87 49 CTTCATTACCAATAGAGTAACTTCAGAAATAGCAGGCGTGTAGAGAATC RNA cleavage UO22+ 
39E 52 CACGTCCATCTCTGCAGTCGGGTAGTTAAACCGACCTTCAGACATAGTGA... RNA cleavage UO22+ 
10-12 28 TGTTTCTCGCTTTGCTGGATGTACTTTT RNA cleavage Mg2+ 
10-12opt 29 CATTTCTCGCTTTGCTGGATGTTACTTTT RNA cleavage Mg2+ 
Dz12-91 26 ACCAACAATGATGCAGCGCATGTGTC RNA cleavage M2+-independent 
Dz12-2 31 ACCAACATGCAGCGTTAGTGTGGGTACGCGT RNA cleavage M2+-independent 
Dz12-3 32 ACCAACATGCAGCGCTAGTGTGAGGCATGCTT RNA cleavage M2+-independent 
Dz12-6 28 ACCAACAGCTAAGTCCGCCGATTGGTGG RNA cleavage M2+-independent 
Dz12-10 28 ACCAACAAGTTATAGTGGTAAGCGGTTG RNA cleavage M2+-independent 
Dz12-11 26 ACCAACAGCACGTACCGGGTTTTTGT RNA cleavage M2+-independent 
Dz12-11b 26 ACCAGCATTGATGCAGCGCATGTGTC RNA cleavage M2+-independent 
S10 20 CGGGGTTTGGGATGAAGGGG RNA cleavage Mn2+ 
Dz12-12 28 ACCAACAGCTAAGTTCGCCATTTGGTGG RNA cleavage M2+-independent 
Dz12-12b 26 ACCAACAAGTTACAGTGGTAGCGGTG RNA cleavage M2+-independent 
Dz12-13 32 ACCAACAATGCCAGCGGCAGTGTCGCTCGCTT RNA cleavage M2+-independent 
Dz12-13b 25 ACCACAGTTACAGTGGTAGCGGTTG RNA cleavage M2+-independent 
Dz12-24 28 ACCAACATACCGCAGCGTGATTAGTGTC RNA cleavage M2+-independent 
C16B 31 AGGAATGGAAAAACATAATGAACAAGGACAA RNA cleavage Pb2+ 
Dz12-26 28 ACCAACAGGCAGCTCGGCCCCGTTTGCG RNA cleavage M2+-independent 
Dz12-28 32 ACCAAAATGCAGCACTAGTGTCTGGCATGTTG RNA cleavage M2+-independent 
Dz12-33 27 ACCAACAGGTTTGCAGCGCGTAGTGTC RNA cleavage M2+-independent 
Dz12-34 29 ACCAACATCATGTAGTACGTAGTGTCGCC RNA cleavage M2+-independent 
Dz12-34b 28 ACCAACAGCTAAGTTTGCGTGTGGGTTC RNA cleavage M2+-independent 
Dz12-44 27 ACCAACAAGTTATAGTGGTAGCGGTTG RNA cleavage M2+-independent 
Dz12-45 32 ACCAACATGCAGCGCTAGTGTGAGGCACGTGT RNA cleavage M2+-independent 
Dz12-47 29 ACCAACACGCAGCGCTAGTGTGAGGCTTC RNA cleavage M2+-independent 
Dz12-51 32 ACCAACATGCAGCGCTAGTGTGAGGCATGTGT RNA cleavage M2+-independent 
Dz12-58 30 ACCAACATGCAGCGCTAGTGTGGGCTCGTT RNA cleavage M2+-independent 
Dz12-59 32 ACCAACATGCAGCGCTAGTGTGCGGCACGCGC RNA cleavage M2+-independent 
Dz12-74 29 ACCAACATGCAGCGCTAGTGTGGGTCGTA RNA cleavage M2+-independent 
Clone11-17 51 CATCTCGGCGAGCAATATGTTCTTGGACTCATTCTATTGACTATTGGTAC... RNA cleavage Zn2+ 
Dz12-80 27 ACCAACAAGTTACAGTGGTAGCGGTTG RNA cleavage M2+-independent 
S4 20 TAGGGTGGGGTTAGAGTGGA RNA cleavage Mn2+ 
Dz12-86 31 ACCAACATGCAGCGCTAGTGTGAGGCATTGT RNA cleavage M2+-independent 
Dz9-3 27 ACCAACACTGCGTGTGTCTTGTGTGCG RNA cleavage M2+-independent 
Dz9-4 33 ACCAACACTAGCAGCGCCAGTGAGGCTCGCGTT RNA cleavage M2+-independent 
Dz9-5 27 ACCAACAGAGAGTGTACTGTGGGTGTA RNA cleavage M2+-independent 
Dz9-9 27 ACCAACATTGTTGCATCGCATGTGATG RNA cleavage M2+-independent 
Dz9-11 27 ACCACATGGTGAGTGTGGACGGTGTTT RNA cleavage M2+-independent 
Dz9-12 27 ACCAACACCGTGTGTGTGTCGTGTGTA RNA cleavage M2+-independent 
Dz9-13 28 ACCAACAGAGAGTGTATCGTGGTGGGTC RNA cleavage M2+-independent 
Dz9-17 27 ACCAACAGAGAGTGTACCATGTGTGTA RNA cleavage M2+-independent 
Dz9-18 28 ACCAACAATGGAGCGCTAGTGATGTTTC RNA cleavage M2+-independent 
Dz9-28 31 ACCAACATTGCCAGCGGTAGTGTCGCTCGCT RNA cleavage M2+-independent 
Dz9-29 29 ACCAACATTGCCAGCGGCAGTGAGGCTTC RNA cleavage M2+-independent 
Dz9-33 31 ACCAACATCGCCAGCGGCAGTGAGGTTCGCA RNA cleavage M2+-independent 
Dz9-36 27 ACCAACATTCCCAGCGGGAGTGTCGCC RNA cleavage M2+-independent 
Dz9-40 28 ACCAACAGGATTGCAGTAGGTTGTGCCG RNA cleavage M2+-independent 
Dz9-43 28 ACCAACAGTGTTTGCTTGGCTATGGCTC RNA cleavage M2+-independent 
Dz9-52 25 ACCAACACCATACAGCGCTAGTGTC RNA cleavage M2+-independent 
Dz9-53 28 ACCAACAACGCATCGTTAGTGAGGGTGC RNA cleavage M2+-independent 
Dz9-54 28 ACCAACATGGTGTGTCTGGGTGGGGTGT RNA cleavage M2+-independent 
Clone11-19 52 CATCTCGATCATACACAACCCTTAGGTTGAACCACATTTCCAGCTTGTGA... RNA cleavage Zn2+ 
Dz9-55 28 ACCAACAGGCACAGGGGGAGTGGTGTTG RNA cleavage M2+-independent 
Dz9-56 29 ACCAACATTGCCAGCGGCAGTGAGTGCAC RNA cleavage M2+-independent 
Dz9-57 26 ACCAACATGTGCACAGTGGTTCGGTG RNA cleavage M2+-independent 
Dz9-59 27 ACCAACAAAGCAGCGTTAGTGAGGCGC RNA cleavage M2+-independent 
Dz9-60 26 ACCAACAGCCTACTAGCGGGAGTGAG RNA cleavage M2+-independent 
Dz9-61 27 ACCAACAGAGAGTGTTTGATGGGTGTG RNA cleavage M2+-independent 
Dz9-63 27 ACCAACAGAGAGTGTTTTATGGGTGTC RNA cleavage M2+-independent 
Dz9-64 30 ACCAACATTAGCAGCGCATGTGGTGGCTTG RNA cleavage M2+-independent 
Tm32 98 CTGCAGAATTCTAATACGAGTCACTATAGGAAGARGGCGAAACATCTTAA... RNA cleavage Tm3+ 
Dz9-67 27 ACCAACACAGTGTGTCACAGCGGTGTA RNA cleavage M2+-independent 
Dz9-77 27 ACCACCCTGGAGTGGACTATGTGGGTA RNA cleavage M2+-independent 
Dz9-81 28 ACCAACATGTCGCGTACGGTTGGTGTTG RNA cleavage M2+-independent 
Dz9-82 28 ACCAACATGAGAGCTTCGTACGGGAGGT RNA cleavage M2+-independent 
Dz9-83 26 ACCAACAGCACGTATCGGGTTTTGTT RNA cleavage M2+-independent 
Dz9-86 26 ACCAACATCATGCAGCGCGTAGTGTC RNA cleavage M2+-independent 
Dz9-92 30 ACCAACATTAGCAGTGCATGTGATGGCTGC RNA cleavage M2+-independent 
Dz9-96 28 ACCAACAGTGAGTGTACTATGTTGTGTC RNA cleavage M2+-independent 
Clone11-6 52 CATCTCTAACTAGTACAGGTTCTATACGATATTTTCTGTATCCATGGTGA... RNA cleavage Zn2+ 
Clone11-7 50 CATCTCGATTGCAAGGATTATAAGAGCTCCAGCCAGATCCTCATCGGACG RNA cleavage Zn2+ 
Clone11-9 48 CATCTCCGAGTAAATCAATGACCTTCATCTCCCTAAACACACGTGACG RNA cleavage Zn2+ 
Clone11-10 51 CATCTCTTGTCAAGTAAAGCCTGCCGGATTCAGCGGTTGTTCGTGTGTAC... RNA cleavage Zn2+ 
Clone11-13 50 CATCTCCACTCCAACGGGGATTATGACATAGTCCCACTATGGTGAGTGCG RNA cleavage Zn2+ 
Clone11-16 52 CATCTCAAATCGACCAATGCCATTAAGCTCCTATGTGTTCTTACTAGTGA... RNA cleavage Zn2+ 
S20 20 TAGGGATAGGGGATAGGGGG RNA cleavage Mn2+ 
Clone11-23 52 CATCTCCATGTGTCAACTCAAGGTTTCTACTTCTTCTGTCCGACAAGTGA... RNA cleavage Zn2+ 
Clone11-25 51 CATCTCCCAATTACGGAATAAGTGAAATGTCTTAGACCTACTATTGTGAC... RNA cleavage Zn2+ 
Clone11-26 52 CATCTCAAGTCCAACCATCCTCAATAGTGCGGGATTAGGGCACCGTGTGA... RNA cleavage Zn2+ 
Clone11-30 52 CATCTCGTGCGACAACTCGAGACGCTTTATGCTGTTTAAATTTTCCGTGA... RNA cleavage Zn2+ 
Clone11-31 52 CAGCTCCGCATGTATCCCAGAGACTTACTGGCCTGATGCTAGCGGTGTGA... RNA cleavage Zn2+ 
Clone11-32 52 CATCTCGTATGCTGATGCTGGTGCACATGGCGTGACTGATAATCCGGTGA... RNA cleavage Zn2+ 
Clone11-33 54 CATCTCATTTACTGCTACCTGTTACTGAGCCACAATTGCCCTTACATTAG... RNA cleavage Zn2+ 
Clone11-34 52 CATCTCTACAGATAGATCAAGACGTCTGGTAGCCTTGCTGTTGGATGGTA... RNA cleavage Zn2+ 
Clone11-40 52 CATCTCTGTTCGCCTCACCCGCTTCGCCCAACTCGCACCTTTATTAGTGA... RNA cleavage Zn2+ 
AgB2 59 TTTCGCCATCTTTAGGCGATTTCCTTTTGGAAACGGGGCAGCGTGTAGTG... RNA cleavage Ag+ 
Clone11-42 51 CATCTCGCACGTCGTTTCTATTTAGGAAAGAATTAACCTAGGCCTGGTAC... RNA cleavage Zn2+ 
Clone11-43 51 CATCTCAAGTAATAAATCGACGACAGATTGGTTTTTTATACCCACGGTAC... RNA cleavage Zn2+ 
Clone11-44 52 CATCTCAACGTTGCGCTACGCGATTTGTAGTTGCCTTGCCTTGGTTGTGA... RNA cleavage Zn2+ 
Clone11-46 52 CATCTCCCGACTGGAACCATTGGTACCCTTTAGCAAGGAGCATAATGTGA... RNA cleavage Zn2+ 
Clone11-47 52 CATCTCTCTGGTTGCTGATTCGTATGATTGTCTTAACTACAGGAGCGTGA... RNA cleavage Zn2+ 
Clone11-48 50 CATCTTGCATGCCCCAAACACATTCAACACTGCTAAATTGCATTGTGACG RNA cleavage Zn2+ 
Clone11-50 51 CATCTCGAACAATGCTCATGGTTTGATGACTGTTGATTGTGCGCTTGTAC... RNA cleavage Zn2+ 
Clone11-51 51 CATCTCGAGAGGAGTGGATATACCTTGGATTTAGGGCTATCTACCCGTAC... RNA cleavage Zn2+ 
Clone11-55 53 CATCTCTGCTTCGCAGTAGGCCAATTATCTCATTCTACCTGCTTGTCGTG... RNA cleavage Zn2+ 
Clone11-57 52 CATCTCGTTAACGTGTTGAGCGGACCGAGTGATCTGATATTTCACCGTGA... RNA cleavage Zn2+ 
Clone11-63 47 CAGCCATAGTTCTACCAGCGGTTCGAAATAGTGAAGTGTTCGTGACT RNA cleavage Zn2+ 
Clone11-65 51 CATCTCCTACCTCCACATTGAGCCGAATTGTCGCCTATTGATACGGGTAC... RNA cleavage Zn2+ 
Clone11-66 52 CATCTCAGTATACACGTCGTGATGAACGATAGATGCTTTTACCTNCGGTA... RNA cleavage Zn2+ 
Clone11-67 52 CATCTCAGCATCGCTAGCCCACTACGGGCGCCCGCGCGGCCAATTGGTGA... RNA cleavage Zn2+ 
Clone11-73 52 CATCTCGATAAAGGTGATTTTAGACTACACTGAGTTAGCTAATCTCGTGA... RNA cleavage Zn2+ 
S21 20 GGGTGGATGGCGAGTGGCAG RNA cleavage Mn2+ 
Clone11-74 53 CATCTCAGTAAGTGATAATCAAATCGCCCACGTAATACCTNCCATGTGTG... RNA cleavage Zn2+ 
Clone11-75 51 CATCTCGAGCCTTAGCCAGTCGGCCCGTCTCGCTCGGATCTCGTCCGTAC... RNA cleavage Zn2+ 
Clone11-76 51 CATCTCATTAGCGTACACATTTCATCTTACGACCCTTGTTTACCCCGTAC... RNA cleavage Zn2+ 
Clone11-79 49 CATCTCGTGTCTGGTAACGTACACCGTTAATCTAGATCCTACTGGGTCG RNA cleavage Zn2+ 
Clone11-81 52 CATCTCCTGGCCCAACGGCGTGAAATCTAGCTTGCCTTTACTTATAGTGA... RNA cleavage Zn2+ 
Clone11-83 52 CATCTCCCCACAACACTCGATTAAANCCGGGTCTAGTTATCGCGGTGTGT... RNA cleavage Zn2+ 
Clone11-86 51 CATCTCGGATCGGAGACGTTCTTATCAATTCACTTACACGGCCGAGTGGC... RNA cleavage Zn2+ 
Clone11-87 50 CATCTCGGGCCACATAACTGATCCTTAAGGCCTATGAGATTGTTGTGACG RNA cleavage Zn2+ 
Clone11-88 51 CACCTCGAAGACCCGCGTTGCACCTGATCAGTTGGGGCCATCCTTGTGAC... RNA cleavage Zn2+ 
Clone11-89 52 CATCTCTACTGAGTTACTCCCACGGTAGCCTTCATTTGGATTGGTCGTGA... RNA cleavage Zn2+ 
C17A 5 TACAA RNA cleavage Pb2+ 
Clone11-90 52 CATCTCCGAAGTACGTTTGTCGTTTGTTAGTTAACGAACGGGGCTGGTGA... RNA cleavage Zn2+ 
Clone11-91 51 CATCTCGGGACCGTAGACCACGTGCGGAAGGTGGTCACGGCTTGCTGTAC... RNA cleavage Zn2+ 
Clone11-92 52 CATCTCCCTTAGATCGGTTTATTCTGGTCCCAATTCTCTCAGGTTTGTAA... RNA cleavage Zn2+ 
Clone11-93 49 CATCTGAAGTCGATAGNNTCTCGACTATAGATGANNAATGGTGGGTACG RNA cleavage Zn2+ 
Clone11-95 51 CATCTCAATTAGCTAGTATACAGGTGAGCTATACAGGATGTACCCCGTAC... RNA cleavage Zn2+ 
SC8 40 GCGGGCCCCAATTCATTGGCTTAACTACGAGGACGTCCAG RNA ligation Mn2+ 
SC9 40 GTACGGACGTCAGTCACGAGGCAGCTGCTTTGCCAAACTG RNA ligation Mn2+ 
SC26 40 ACCGTCACAAAAGACTGTAGTTAATACCACTGCAGGTCGT RNA ligation Mn2+ 
SC34 40 GCACAGGGGTATAATTGCCTCGTACAACTTTATGTCCGAA RNA ligation Mn2+ 
Dz7-38-39 45 TTACAGTGGTATCGATTGGGACGTGTGGAGCGTCAGGATGGTATA RNA cleavage M2+-independent 
AgB0 65 TTTCGCCATCTTTGGAGCCATAGGTCAAAGGTGGGTGTGGTCTACCAGCA... RNA cleavage Ag+ 
AgB1 59 TTTCGCCATCTTTAGGCGATTTCCTTTTGGAAACGGGGCAGCGTATAGTG... RNA cleavage Ag+ 
C17B 28 TACAAGACTCAGTTCTACCTGAGTGGTT RNA cleavage Pb2+ 
AgB3 59 TTTCGCCATCTTTAAGTGATTTCCTTTTGGAAACAGGGCAGCGTATAGTG... RNA cleavage Ag+ 
AgB4 59 TTTCGCCATCTTTAGGTGATTTCCTTTTGGAAACAGGGCAGCGTGTAGTG... RNA cleavage Ag+ 
AgB5 59 TTTCGCCATCTTTAGGTGATTTCCTTTTGGAAACAGGGCAGCATATAGTG... RNA cleavage Ag+ 
AgB6 59 TTTCGCCATCTTTAGGTGATTTCCTTTTGGAAACGGGGCAGCGTATAGTG... RNA cleavage Ag+ 
AgB7 59 TTTCGCCATCTTTAGGCGATTTCCTTTTGGAAACAGGGCAGCGTATAGTG... RNA cleavage Ag+ 
AgB8 59 TTTCGCCATCTTTGGGTGATTTCCTTTTGGAAACAGGGCAGCGTATAGTG... RNA cleavage Ag+ 
AgB9 60 TTTCGCCATCTTTGAGGTGATTTCCTTTTGGAAATGAAATAACGTATAGT... RNA cleavage Ag+ 
AgB10 60 TTTCGCCATCTTTGAGGTGATTTCCTTTTGGAAATGAAGTAACATATAGT... RNA cleavage Ag+ 
AgB1-del-A7 58 TTTCGCCATCTTTAGGCGTTTCCTTTTGGAAACGGGGCAGCGTATAGTGA... RNA cleavage Ag+ 
AgB1b 54 TTTCGCCATCTTTAGGTTTCCTTTTGGAAAGGGCAGCGTATAGTGACTCG... RNA cleavage Ag+ 
AgB1c 52 TTTCGCCATCTTTAGGCGTCTTTTGACGGGGCAGCGTATAGTGACTCGTG... RNA cleavage Ag+ 
AgB1d 48 TTTCGCCATCTTTAGGCGTTAACGGGGCAGCGTATAGTGACTCGTGAC RNA cleavage Ag+ 
NaH1 49 GGAGCCATAGGTCAAAGGTGGGTGTGGTCGTATCATATCGACCAGCAWT RNA cleavage Na+ 
Gd2b 49 TCGCCATCTTGACGCATATCGTTTTCGATAGCACGTGTTAGTGACTCGT RNA cleavage Gd3+ 
Gd2 71 TCGCCATCTTGACGCATATCGGCGACCAATAAAATCAGAGGTAAAGACGA... RNA cleavage Gd3+ 
Gd2a 63 TCGCCATCTTGACGCATATCGGCGACCTTTTGGTAAAGACGATAGCACGT... RNA cleavage Gd3+ 
Gd2c 39 TTTCGCCATCTTGACGCATAGCACGTGTTAGTGACTCGT RNA cleavage Gd3+ 
Dz7-38-83 46 TTACAGTGGTATCGATTGGGACGTGTGTAGCGTCAGGATGGGATCA RNA cleavage M2+-independent 
Ce13 118 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTGG... RNA cleavage Ce3+ 
Ce13a 61 TTTCGCCATAGGTCAAAGGTGGGTGCGAGTCGTATCATATCGACTCGTTA... RNA cleavage Ce3+ 
Ce13b 59 TTTCGCCATAGGTCAAAGGTGGGTGCGGGTCGTTTTTCGACTAAGTTATA... RNA cleavage Ce3+ 
Ce13c 41 TTTCGCCATAGGTCAAAGGTGGGTGCGTTATAGTGACTCGT RNA cleavage Ce3+ 
Ce13d 53 TTTCGCCATAGGTCAAAGGTGGGTGCGAGTTTTTACTCGTTATAGTGACT... RNA cleavage Ce3+ Cr3+ 
Ce20 118 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATTTGGA... RNA cleavage Ce3+ 
Ce22 116 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATTGGAG... RNA cleavage Ce3+ 
Ce6 116 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATGGAGC... RNA cleavage Ce3+ 
Ce4 119 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTGG... RNA cleavage Ce3+ 
Ce34 117 CTGCAGAATTCTAAACGAGTCACTATAGGAAGATGGCGAAACATCCTGGA... RNA cleavage Ce3+ 
Ce9 118 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTGG... RNA cleavage Ce3+ 
Ce3 118 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTGG... RNA cleavage Ce3+ 
Ce11 118 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTGG... RNA cleavage Ce3+ 
Ce15 113 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTTA... RNA cleavage Ce3+ 
Ce5 118 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTTA... RNA cleavage Ce3+ 
Ce2 116 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTTA... RNA cleavage Ce3+ 
Ce16 116 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTTA... RNA cleavage Ce3+ 
Ce12 117 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTAA... RNA cleavage Ce3+ 
Ce23 117 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTAA... RNA cleavage Ce3+ 
Ce10 119 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTTA... RNA cleavage Ce3+ 
Ce14 112 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTTT... RNA cleavage Ce3+ 
Ce32 119 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTTA... RNA cleavage Ce3+ 
Ce7 119 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTCAC... RNA cleavage Ce3+ 
Tm7 98 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTCG... RNA cleavage Tm3+ Er3+ 
Ho7 98 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTAG... RNA cleavage Ho3+ 
Ho13 98 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTAG... RNA cleavage Ho3+ 
Ho14 98 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTAG... RNA cleavage Ho3+ 
Er5 98 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTTG... RNA cleavage Er3+ 
Er1 98 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTCG... RNA cleavage Er3+ 
Er16 98 CTGCAGAATTCTAATACSAGTCACYMTAGGAAGATGGCGAAACATCTTAG... RNA cleavage Er3+ 
Er18 98 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTGA... RNA cleavage Er3+ 
Er39 92 CTGCAGAATTCTAATACCTATAGGAAGATGGCGAAACATCTTGATTCTCT... RNA cleavage Er3+ 
Er11 98 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTGA... RNA cleavage Er3+ 
Tm4 98 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTCA... RNA cleavage Tm3+ 
Tm26 97 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTAA... RNA cleavage Tm3+ 
Ho12 98 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTAT... RNA cleavage Ho3+ 
Tm27 96 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTCT... RNA cleavage Tm3+ 
Ho9 98 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTCA... RNA cleavage Ho3+ 
Er34 98 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTCG... RNA cleavage Er3+ 
Tm14 95 CTGCAGAATTCTAATAGAGTCACTATGGAAGATGGCGAAACATCTTCAAA... RNA cleavage Tm3+ 
Ho2 98 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTAG... RNA cleavage Ho3+ 
Er22 97 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTCT... RNA cleavage Er3+ 
Ho6 98 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTAA... RNA cleavage Ho3+ 
Er32 98 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTTT... RNA cleavage Er3+ 
Er24 98 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTTA... RNA cleavage Er3+ 
Er30 97 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTTA... RNA cleavage Er3+ 
Ho4 98 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTCA... RNA cleavage Ho3+ 
Ho11 98 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTCT... RNA cleavage Ho3+ 
Er36 98 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTTA... RNA cleavage Er3+ 
Er4 98 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTAG... RNA cleavage Er3+ 
Tm16 98 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTAA... RNA cleavage Tm3+ 
Er23 98 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCCTCA... RNA cleavage Er3+ 
Ho15 97 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTCT... RNA cleavage Ho3+ 
Tm8 97 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTCA... RNA cleavage Tm3+ 
Ho1 98 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTAG... RNA cleavage Ho3+ 
Er6 97 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTAG... RNA cleavage Er3+ 
Er13 98 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTCG... RNA cleavage Er3+ 
Er31 98 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTAT... RNA cleavage Er3+ 
Er25 98 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTGG... RNA cleavage Er3+ 
Er35 97 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTAG... RNA cleavage Er3+ 
Tm17 98 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTGA... RNA cleavage Tm3+ 
Er12 98 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTGT... RNA cleavage Er3+ 
Er26 97 CTGCAGAATTTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTCGA... RNA cleavage Er3+ 
Er27 98 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTTT... RNA cleavage Er3+ 
Bipartite I 40 TCTCTTTCTGCGGAGGAGGTAGGGGTTCCGCTCCAAGGGC RNA cleavage Mn2+ Mg2+ 
Er33 98 CGCCCTTAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTT... RNA cleavage Er3+ 
Tm1 97 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTGT... RNA cleavage Tm3+ 
Er9 96 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTTA... RNA cleavage Er3+ 
Er20 95 CTGCAGAATTCTAATACGATCACTATAGGAAGATGGCGAAACATCTTTAC... RNA cleavage Er3+ 
Er10 96 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTTA... RNA cleavage Er3+ 
Tm3 96 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTTA... RNA cleavage Tm3+ 
Tm22 96 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTTA... RNA cleavage Tm3+ 
Er37 96 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTTA... RNA cleavage Er3+ 
Ho3 96 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTTA... RNA cleavage Ho3+ 
Ho10 98 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTTA... RNA cleavage Ho3+ 
Er2 97 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTTA... RNA cleavage Er3+ 
Er17 97 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTTA... RNA cleavage Er3+ 
Er28 97 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTTA... RNA cleavage Er3+ 
Ho8 97 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTTA... RNA cleavage Ho3+ 
Er19 97 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTTA... RNA cleavage Er3+ 
Er38 97 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTTA... RNA cleavage Er3+ 
Ho5 96 CTGCAGAATTCCAATACGAGTCACTATAGGAAGATGGCGAAACATCTTTA... RNA cleavage Ho3+ 
Er15 98 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTTG... RNA cleavage Er3+ 
Dy1 (identical to Dy17) 112 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTTA... RNA cleavage Dy3+ 
MgZ-9 63 TCAAAGAGTTGAATGAGGGGGTCGCTGGGTTCTGGGGCGGGATTCATTCG... RNA cleavage Mg2+ 
C18 18 AGAGCCAAAAGGACGTCC RNA cleavage Pb2+ 
Dy17 (identical to Dy1) 112 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTTA... RNA cleavage Dy3+ 
Dy10 112 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTTA... RNA cleavage Dy3+ 
Dy35 111 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTAT... RNA cleavage Dy3+ 
Dy6 113 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTTA... RNA cleavage Dy3+ 
Dy27 113 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTTA... RNA cleavage Dy3+ 
Dy25 113 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTTA... RNA cleavage Dy3+ 
Dy16 112 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTTA... RNA cleavage Dy3+ 
Dy34 111 CTGCAGAATTCTAATACGATCACTATAGGAAGATGGCGAAACATCTTTAC... RNA cleavage Dy3+ 
Dy12 113 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTTA... RNA cleavage Dy3+ 
Dy7 113 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTTA... RNA cleavage Dy3+ 
Dy37 112 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTTA... RNA cleavage Dy3+ 
Dy8 111 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTTA... RNA cleavage Dy3+ 
Dy19 112 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTTA... RNA cleavage Dy3+ 
Dy23 113 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTTA... RNA cleavage Dy3+ 
Dy29 112 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTTA... RNA cleavage Dy3+ 
Dy32 112 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTTA... RNA cleavage Dy3+ 
Dy9 113 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTTA... RNA cleavage Dy3+ 
Dy30 112 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTTA... RNA cleavage Dy3+ 
Dy38 112 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTTA... RNA cleavage Dy3+ 
MgZ-2 64 TCGACCAGGTCGGGGCCTGGAGGGGAGGCTATGCGAAGGTTTGGTGACGA... RNA cleavage Mg2+ 
6-60 37 CGTTGCCTGAGGAGGTAGGGGTTCCGGACCAATTCTT RNA cleavage metal ion dependency not reported 
Dy13 113 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTTA... RNA cleavage Dy3+ 
Dy14 113 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTTA... RNA cleavage Dy3+ 
Dy24 113 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTTA... RNA cleavage Dy3+ 
Dy31 112 CTGCAGATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTTAC... RNA cleavage Dy3+ 
Dy40 113 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTTA... RNA cleavage Dy3+ 
Dy11 112 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTTA... RNA cleavage Dy3+ 
Dy15 113 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTTA... RNA cleavage Dy3+ 
Dy18 112 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATTATGG... RNA cleavage Dy3+ 
Dy33 112 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACAAAATGG... RNA cleavage Dy3+ 
Dy28 112 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCATGG... RNA cleavage Dy3+ 
Dy20 111 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCATGG... RNA cleavage Dy3+ 
Dy26 111 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCATGG... RNA cleavage Dy3+ 
Dy3 111 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATTTGGA... RNA cleavage Dy3+ 
Dy4 111 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTCGG... RNA cleavage Dy3+ 
Dy5 110 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCCGGG... RNA cleavage Dy3+ 
Dy36 110 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTGGG... RNA cleavage Dy3+ 
Dy2 113 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTGG... RNA cleavage Dy3+ 
Dy22 112 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTTA... RNA cleavage Dy3+ 
Dy10a 60 TTTCGCCATCTTTATTGCGTAAAGCATCAGTTTTCTGATACAAGGATAGT... RNA cleavage Sm3+ 
EtNa 53 TTTCGCCATCTTTTCTCACACCGTACTCGGTAAGGTTGTTAGTGACTCGT... RNA cleavage Na+ M2+-independent 
PSCu10 119 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTCA... RNA cleavage Cu2+ 
PSCu2 119 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTAA... RNA cleavage Cu2+ 
PSCu8 120 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTAA... RNA cleavage Cu2+ 
PSCu9 119 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTTC... RNA cleavage Cu2+ 
PSCu24 119 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTGC... RNA cleavage Cu2+ 
BN-Cd35 114 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTGC... RNA cleavage Cd2+ 
PSCu6 120 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTTC... RNA cleavage Cu2+ 
PSCu12 119 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTTC... RNA cleavage Cu2+ 
PSCu23 119 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTGG... RNA cleavage Cu2+ 
PSCu11 119 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTCA... RNA cleavage Cu2+ 
PSCu5 119 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTCA... RNA cleavage Cu2+ 
PSCu18 119 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTCA... RNA cleavage Cu2+ 
PSCu4 119 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTTT... RNA cleavage Cu2+ 
PSCu15 119 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTAT... RNA cleavage Cu2+ 
PSCu19 119 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTAT... RNA cleavage Cu2+ 
PSCu25 120 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACAATCTTA... RNA cleavage Cu2+ 
C20 31 AGGGAAAGAAAAAGGCGGGGAAGTAACGAGA RNA cleavage Pb2+ 
PSCu22 120 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACAATCTTA... RNA cleavage Cu2+ 
PSCu21 120 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACAATCTTA... RNA cleavage Cu2+ 
PSCu1 119 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTAT... RNA cleavage Cu2+ 
PSCu14 119 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTAT... RNA cleavage Cu2+ 
PSCu17 119 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTAT... RNA cleavage Cu2+ 
PSCu16 119 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTAT... RNA cleavage Cu2+ 
PSCu20 119 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTAT... RNA cleavage Cu2+ 
PSCu3 119 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTAC... RNA cleavage Cu2+ 
PSCu13 119 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTAC... RNA cleavage Cu2+ 
PSCu7 119 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTAA... RNA cleavage Cu2+ 
UNBlkCd07 111 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTGGG... RNA cleavage Cd2+ 
UNBlkCd34 112 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTGGG... RNA cleavage Cd2+ 
UNBlkCd14 112 CTGCAGAATTCTAATACGAGTCACTATAGGAAGTTGGCGAAACATTTCGA... RNA cleavage Cd2+ 
UNBlkCd04 112 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATGGAGC... RNA cleavage Cd2+ 
UNBlkCd08 113 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCATGG... RNA cleavage Cd2+ 
UNBlkCd23 111 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATGGAGC... RNA cleavage Cd2+ 
C21 15 ATACCCAACAGGAAC RNA cleavage Pb2+ 
UNBlkCd30 112 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATGGAGC... RNA cleavage Cd2+ 
Ni03a 36 GTCGCCAAACTCAAGAAGAGGACCAGGTAGTGAGGT RNA cleavage Ni2+ 
Ni03b 37 GTCGCCAAACTCAAGAAGAGGACCAGGATAGTGAGGT RNA cleavage Ni2+ 
Ni03c 36 GTCGCCAAGCTCAAGAAGAGGACCAGGTAGTGAGGT RNA cleavage Ni2+ 
Ni03d 34 GTCGCCACTCAAGAAGAGGACCAGGTAGTGAGGT RNA cleavage Ni2+ 
Ni03l 34 GTCGCCACTCAAGAAGAGGACCAGATAGTGAGGT RNA cleavage Ni2+ 
17E 33 CATCTCTTCTCCGAGCCGGTCGAAATAGTGAGT RNA cleavage Zn2+ 
class I 40 TTTTGTCAGCGACTCGAAATAGTGTGTTGAAGCAGCTCTA RNA cleavage Zn2+ 
class II 39 TAGTTCTACCAGCGGTTCGAAATAGTGAAGTGTCCGTGA RNA cleavage Zn2+ 
UNBlkCd22 112 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATTGAGC... RNA cleavage Cd2+ 
UNBlkCd05 111 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATGGAGC... RNA cleavage Cd2+ 
UNBlkCd21 111 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATGGAGC... RNA cleavage Cd2+ 
UNBlkCd03 113 CTGCAGAATTCTAATACGAGTCACTATAAGGAAGATGGCGAAACATGGAG... RNA cleavage Cd2+ 
UNBlkCd36 112 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATGGAGC... RNA cleavage Cd2+ 
UNBlkCd15 112 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATGGAGC... RNA cleavage Cd2+ 
UNBlkCd11 112 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATGGAGC... RNA cleavage Cd2+ 
UNBlkCd10 112 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATGGAGC... RNA cleavage Cd2+ 
UNBlkCd09 112 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATGGAGC... RNA cleavage Cd2+ 
MgZ-8 64 TCAACCAGGTCGGGGCCCGGAGGGGAGGCTATGCGAAGGTTTGGTGACGA... RNA cleavage Mg2+ 
12-36 40 GCTCTTAGGAGGTAGGGGTTCCGATCCAGGTGGCTGGGTA RNA cleavage metal ion dependency not reported 
UNBlkCd06 112 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATGGAGC... RNA cleavage Cd2+ 
UNBlkCd17 112 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATGGAGC... RNA cleavage Cd2+ 
UNBlkCd37 112 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATGGAGC... RNA cleavage Cd2+ 
UNBlkCd40 112 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATGGAGC... RNA cleavage Cd2+ 
UNBlkCd35 112 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATGGAGC... RNA cleavage Cd2+ 
UNBlkCd02 112 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATGGAGC... RNA cleavage Cd2+ 
UNBlkCd38 112 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATGGAGC... RNA cleavage Cd2+ 
UNBlkCd26 113 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATGGAGC... RNA cleavage Cd2+ 
UNBlkCd25 113 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATGGAGC... RNA cleavage Cd2+ 
UNBlkCd19 113 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATGGAGC... RNA cleavage Cd2+ 
UNBlkCd12 113 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATGGAGC... RNA cleavage Cd2+ 
UNBlkCd28 113 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATGGAGC... RNA cleavage Cd2+ 
UNBlkCd27 111 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATGGAGC... RNA cleavage Cd2+ 
UNBlkCd29 112 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATGAGCC... RNA cleavage Cd2+ 
UNBlkCd33 111 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATGAAGC... RNA cleavage Cd2+ 
UNBlkCd13 112 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATGGAGC... RNA cleavage Cd2+ 
UNBlkCd24 112 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATGGAGC... RNA cleavage Cd2+ 
UNBlkCd20 116 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTTA... RNA cleavage Cd2+ 
UNBlkCd39 116 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTTA... RNA cleavage Cd2+ 
BlkCd07 106 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTCA... RNA cleavage Cd2+ 
BlkCd26 107 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTCA... RNA cleavage Cd2+ 
BlkCd03 106 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTAT... RNA cleavage Cd2+ 
BlkCd10 106 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTAA... RNA cleavage Cd2+ 
BlkCd31 106 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTCA... RNA cleavage Cd2+ 
BlkCd18 107 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTAG... RNA cleavage Cd2+ 
BlkCd23 106 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATTTTTA... RNA cleavage Cd2+ 
BN-Cd12 114 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTGC... RNA cleavage Cd2+ 
BN-Cd09 114 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTAG... RNA cleavage Cd2+ 
BN-Cd34 114 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTAG... RNA cleavage Cd2+ 
BN-Cd24 114 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTAG... RNA cleavage Cd2+ 
MgZ-11 64 TCAACCAGGTCGGGGCCCGGAGGGGAGGCTATGTGAAGGTTTGGTGACGA... RNA cleavage Mg2+ 
BN-Cd25 114 CTGCAGAATTCTAATACSAGTCACTATAGGAAGATGGCGAAACATCTTAA... RNA cleavage Cd2+ 
BN-Cd36 114 CTGCAGAATTCTAATACSAGTCACTATAGGAAGATGGCGAAACATCTTAT... RNA cleavage Cd2+ 
BN-Cd17 114 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTTT... RNA cleavage Cd2+ 
BN-Cd23 114 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTTT... RNA cleavage Cd2+ 
CT10-3.29T 59 CAAATTGATCGGTGGGGAGCAACTGAAAGGCGGTTGCAATGCGGATGGAT... RNA cleavage Mn2+ Mg2+ 
BlkCd19 106 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTTT... RNA cleavage Cd2+ 
BlkCd16 106 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTTA... RNA cleavage Cd2+ 
BlkCd01 106 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTTA... RNA cleavage Cd2+ 
BlkCd27 106 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTTA... RNA cleavage Cd2+ 
BlkCd15 106 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTTA... RNA cleavage Cd2+ 
BlkCd21 106 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTTA... RNA cleavage Cd2+ 
BlkCd02 106 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTTA... RNA cleavage Cd2+ 
BlkCd22 106 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTAA... RNA cleavage Cd2+ 
BlkCd30 106 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTTA... RNA cleavage Cd2+ 
BlkCd09 106 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTTA... RNA cleavage Cd2+ 
BlkCd24 106 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTTA... RNA cleavage Cd2+ 
BlkCd36 106 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTTA... RNA cleavage Cd2+ 
BlkCd06 106 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTTA... RNA cleavage Cd2+ 
BlkCd11 106 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTTA... RNA cleavage Cd2+ 
BlkCd14 106 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTTG... RNA cleavage Cd2+ 
BlkCd39 107 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTTA... RNA cleavage Cd2+ 
BlkCd12 106 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTTA... RNA cleavage Cd2+ 
BlkCd38 106 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTTA... RNA cleavage Cd2+ 
BlkCd33 106 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTTA... RNA cleavage Cd2+ 
BlkCd40 106 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTTA... RNA cleavage Cd2+ 
BlkCd20 106 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACACCTTTA... RNA cleavage Cd2+ 
BlkCd25 106 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTTA... RNA cleavage Cd2+ 
BlkCd32 106 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTTA... RNA cleavage Cd2+ 
BlkCd35 106 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTTA... RNA cleavage Cd2+ 
BlkCd28 106 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACACCTTTA... RNA cleavage Cd2+ 
BlkCd05 106 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTTA... RNA cleavage Cd2+ 
C22 (PbE22) 5 GAAGC RNA cleavage Pb2+ 
BlkCd17 105 CTGCAGAATTCTAATACGAGTCACTATAGGAAATGGCGAAACATCTTTAG... RNA cleavage Cd2+ 
BlkCd04 106 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTTA... RNA cleavage Cd2+ 
clone 32 50 CCATTCTCCTCTGCTGGACTATTCGGGTCTTTGTTCTCTCATGGTTGTGT RNA cleavage M2+-independent 
BlkCd13 106 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTTA... RNA cleavage Cd2+ 
BlkCd08 106 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTTA... RNA cleavage Cd2+ 
BlkCd34 95 CTGCAGAATTCGCCCTTGGAAGATGGCGAAACATCTTTAGTAATGGTCTC... RNA cleavage Cd2+ 
BN-Cd02 114 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTAG... RNA cleavage Cd2+ 
BN-Cd20 114 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTAG... RNA cleavage Cd2+ 
BN-Cd01 114 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTTA... RNA cleavage Cd2+ 
BN-Cd10 114 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTTA... RNA cleavage Cd2+ 
BN-Cd06 114 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACACCTTTA... RNA cleavage Cd2+ 
BN-Cd30 114 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTTA... RNA cleavage Cd2+ 
BN-Cd13 114 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACACCTTGC... RNA cleavage Cd2+ 
BN-Cd14 114 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACACCTTGC... RNA cleavage Cd2+ 
BN-Cd38 114 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATATTGC... RNA cleavage Cd2+ 
BN-Cd04 113 CTGCAGAATTCTAATACGAGTCACTATAGGAGATGGCGAAACATTTAGGG... RNA cleavage Cd2+ 
MgZ-5 64 TCAACCAGGTCGGGGCCGAAATATAATAGAAAGTGAAGATGTTTTGGGAG... RNA cleavage Mg2+ 
C24 31 AGTGGAGCAAAAAAGGTTCCAAAGGGATCGG RNA cleavage Pb2+ 
BN-Cd21 114 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTGG... RNA cleavage Cd2+ 
BN-Cd40 113 CTGCAGAATTCTAATAGAGTCACTATAGGAAGATGGCGAAACATCTTGGG... RNA cleavage Cd2+ 
BN-Cd07 114 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTGC... RNA cleavage Cd2+ 
BN-Cd11 114 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTTT... RNA cleavage Cd2+ 
BN-Cd03 114 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACACCTTAC... RNA cleavage Cd2+ 
BN-Cd37 114 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACACCTTAC... RNA cleavage Cd2+ 
BN-Cd05 115 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACAATCTTC... RNA cleavage Cd2+ 
BN-Cd08 114 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTCA... RNA cleavage Cd2+ 
BN-Cd15 115 CTGCAGAATTCTAATAACGAGTCACTATAGGAAGATGGCGAAACATCTTC... RNA cleavage Cd2+ 
BN-Cd29 114 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACACCTTCA... RNA cleavage Cd2+ 
BN-Cd19 114 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACACCTTCA... RNA cleavage Cd2+ 
BN-Cd33 114 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACACCTTCA... RNA cleavage Cd2+ 
BN-Cd26 114 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTCA... RNA cleavage Cd2+ 
BN-Cd16 114 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTTC... RNA cleavage Cd2+ 
BN-Cd22 114 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTTC... RNA cleavage Cd2+ 
BN-Cd32 114 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTTA... RNA cleavage Cd2+ 
BN-Cd39 114 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACACCTTTA... RNA cleavage Cd2+ 
C25A 19 AAGAAAGGCCATAGGAGCC RNA cleavage Pb2+ 
BN-Cd18 114 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTTA... RNA cleavage Cd2+ 
Ni03 68 CGCCATCTTTAGAAATATTATAAGCCTAATAGATGCCCAAACTCAAGAAG... RNA cleavage Ni2+ 
Ni02 68 CGCCATCTTTTGAGGTCAGCTGACCTCTAAAAGCACTAAGCTCAAGAAGA... RNA cleavage Ni2+ 
class III 40 CAAAGATGCCAGCATGCTATTCTCCGAGCCGGTCGAAATA RNA cleavage Zn2+ 
G2501 50 ATCTTTTCTATCAACCCCAAAACTTTGGCACAATGAAGTGGGTGACTTTT RNA cleavage
16.2-3 50 CCCGAGGCACCAATCCTTCGTTGAGCTCTTACTCGGTGAAACGGCCGCTA RNA cleavage Zn2+ 
16.2-11 50 CCCAGAAGGCCGAAACCGCTTCGTTGACCCCTTGCTCTAGGGTTACTAGG RNA cleavage Zn2+ 
16.2-12 50 GACAGCAATATCTTCGTTGACCCCTTGCTCTATATAGCCTTCAGGCCCCC RNA cleavage Zn2+ 
16.3-4 50 CACACGGGACGCATCGGACTTCGTTGAGCACTTACTCTAGCCGCGCCCAT RNA cleavage Zn2+ 
16.4-3 50 CCACACCGTACACCAGCTCGAGGTTGGGCACCTACTCTAACACCAGCGGT RNA cleavage Zn2+ 
16.4-4 50 GGGACAAATTGGCCATTAGCCCCTTCGTTGAGCACGCTACACTAGGCCCA RNA cleavage Zn2+ 
Dz7-38-32 45 TTACAGTGGTATCGATTGGGACGTGTGGAGCGTCAGGATGGTACA RNA cleavage M2+-independent 
7-10 42 TTACAGTGGTAGCGGTTGGCACGTGTGCAGCGTAAGTGGGCG RNA cleavage M2+-independent 
7-38 42 TTACAGTGGTAGCGGTTGGCATGTGTGCAGCGTAGGTGGGCG RNA cleavage M2+-independent 
7-44 41 TTACAGTGGTAGCGGTGGCATGTGTACAGCGTTAGTGAGTG RNA cleavage M2+-independent 
7-50 42 TTATAGTGGTAGCGGTTGGCATGTGTGTGGCGTGAGTTAGTG RNA cleavage M2+-independent 
7-55 42 TTACAGTGGTAGCGGTTGGCATGTGTGGAGCGTAAGTGAGCG RNA cleavage M2+-independent 
7-57 42 TTACAGTGGTAGCGGTTGGCATGTGTGCAGCGTAAGTGGGCG RNA cleavage M2+-independent 
MgZ-7 64 TCAAGGATTATTACCAGGTCGGGGCCAAATTAACGGGTATTGACATCGAG... RNA cleavage Mg2+ 
7-60 41 TTACAGTCGTAGCGGTGGCATGCGTGCAGAGTAAGTGGGCG RNA cleavage M2+-independent 
7-45 40 AAGCAGCGCATGTGATGGCACGCGTAGTGGCTGGGTAGCT RNA cleavage M2+-independent 
Dz7-38-90 46 TTACAGTGGTATCGATTGGGACGTGTGGAGCGTCAGGATGGGATCA RNA cleavage M2+-independent 
Dz7-45-10 42 AAGCAGCGGATGTGGTGTGACGCGGAGTCCCGAGTAGGGCTT RNA cleavage M2+-independent 
Dz7-45-22 42 AAGCAGCGGATGTGGTGTGACGCGGAGTCCCGGGTAGGGCTT RNA cleavage M2+-independent 
Dz7-45-28 42 AAGCAGCGGACGGATGGATGCGGAGTGCCTGAGTCAGGCCTT RNA cleavage M2+-independent 
Zn01 50 TGTCTCTGACCTCTAGAGTGGAGCAAATCGTAAGGATCCAGTGGACGAAA RNA cleavage Zn2+ 
Zn03 50 GAGTAATAGTCAAGATATAACCAGACAAATCCTTCTGCACGGAGGACAAA RNA cleavage Zn2+ 
Zn05 50 GATGAGAGGACCAATCACACAAATATGTGAGGTGCTGGACTCCAGCGGGA RNA cleavage Zn2+ 
Zn06 50 ACGGAACCAGAGGACGAAATAGATGACTTGAAAATCCAATAACGTATCCA RNA cleavage Zn2+ 
Zn09 119 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATTCTAG... RNA cleavage Zn2+ 
Zn10 119 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCCTTG... RNA cleavage Zn2+ 
Zn08 119 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTAT... RNA cleavage Zn2+ 
Zn04 119 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTGA... RNA cleavage Zn2+ 
Zn02 119 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTGG... RNA cleavage Zn2+ 
Zn07 119 CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTAT... RNA cleavage Zn2+ 
MgZ 49 GAACCAGGTCGGGGCCGAAATATAGGATATTTTGGGAGGCTATGCTAGG RNA cleavage Mg2+ 
MgZ-1 64 TCAAAGAGTCGAATGAGGGGGTCGCTGGGTTCTGGGGCGGGATCTATTCG... RNA cleavage Mg2+ 
MgZ-3 64 TCAAAGAGTCGAATGAGGGGGTCGCTGGGTTCTGGGGCGTGATTCATTTG... RNA cleavage Mg2+ 
MgZ-4 64 TCAAAGAGTCGAATGAGGGGGTCGCTGGGTTCTGGGGCGGGATTCATTCG... RNA cleavage Mg2+ 
MgZ-6 63 TCAAGAGTCGAATGAGGGGGTCGCTGGGTTCTGGGGCGGGATTCATTCGA... RNA cleavage Mg2+ 
G12SD-2 64 TCAATGTAATCAAATGTCGTGAAGGGGTTTTGACGCCAGAGGGCGGAAAT... RNA cleavage Mg2+-independent 
G12SD-1 63 TCAACTGAACTATCTGGGGCAATCAGAGAATCGTAGGGTTTGAGGTTCGG... RNA cleavage Mg2+-independent 
614 41 ACATCATGCGAGCACACGCAATAGCCTGATAAGGTTGGTAG RNA cleavage Mg2+-independent 
5J-B38 60 TCGAGGTACCAAATATTGTAAATATTGATGGCTGCCGGGCAGACAGTCGG... RNA cleavage Mn2+ Ni2+ Co2+ 
62/615 40 ACACGCACGGACTTGTACGTATATAGCGTAAGGTTGATAG RNA cleavage Mg2+-independent 
616 38 ACTGCACAATCCAACACCGATTGCAAAGGTTGTTAGGG RNA cleavage Mg2+-independent 
G12SD-4 64 TCAATATAATCAAATGTCGTGAAGGGGTTTTGACGCTAGAGGGCGGAAAT... RNA cleavage metal ion dependency not reported 
G12SD-5 64 TCAATGTAATCAAATGTCGTGAAGGGGTTTTGACGCCAGAGGGCGGAAAT... RNA cleavage metal ion dependency not reported 
G12SD-6 64 TCTATGTAATCAAATGTCGTGAAGGGGTTTTGACGCCAGAGGGCGGAAAT... RNA cleavage metal ion dependency not reported 
G12SD-9 64 TCAATGTAATCAAATGTCGTGAAGGGGTTTTGACGCCAGAGGGCGGAAAT... RNA cleavage metal ion dependency not reported 
G12SD-14 64 TCAATGTAATCAAATGTCGTGAAGGGGTTTTGACGCTAGAGGGCGGAAAT... RNA cleavage metal ion dependency not reported 
G12SD-16 64 TCAATGTAATCAAATGTCGTGAAGGGGTTTCGACGCTAGGGGGCGGAGAT... RNA cleavage metal ion dependency not reported 
G12SD-18 64 TCAATGTAATCAAATGTCGTGAAGGGGTTTTGACGCTAGAGGGCGGAAAT... RNA cleavage metal ion dependency not reported 
G12SD-19 64 TCAATGTAATCAAATGTCGTGAAGGGGTTTTGACGCCAGAGGGCGGAAAT... RNA cleavage metal ion dependency not reported 
G12SD-20 64 TCAATGTAATCAAATGTCGTGAAGGGGTTTTGACGCCAGAGGGCGGAAAT... RNA cleavage metal ion dependency not reported 
G12SD-3 64 TCAACTGAGCTATCTGGGGCAATCAGAGAAATTGTAGGGTTTGAGGTTCG... RNA cleavage metal ion dependency not reported 
G12SD-7 63 TCAACTGAACTACCTGGGGCAGTCAGAGAATCGTAGGGTTTGAGGTTCGG... RNA cleavage metal ion dependency not reported 
G12SD-8 63 TCAACTGAACTGTCTGGGGCAATCAGGGAATCGTAGGGTTTGAGGTTCGG... RNA cleavage metal ion dependency not reported 
G12SD-10 64 CCAATTGAACTATTTGGGGCAATCAGAGAAATCGTAGGGTTTGAGGTTCG... RNA cleavage metal ion dependency not reported 
G12SD-11 63 TTAACCGAGCTATCTGGGGCAATCGGAGAATCGTAGGGTTTGAGGTTCGG... RNA cleavage metal ion dependency not reported 
G12SD-15 63 TCAACTGGACTATCTGGGGCAATCAGAGAATCGTAGGGTCTGAGGTTCGG... RNA cleavage metal ion dependency not reported 
G12SD-17 64 TTAACTGAACTATCTGGGGCAATCGGAGGAATCGTAGGGTTTGAGGTTCG... RNA cleavage metal ion dependency not reported 
G12SD-12 64 TCAAGAATGTGGGGGGAAAGGGGGAAGGGGGGCAAAGGACGGAGTGGGGT... RNA cleavage metal ion dependency not reported 
G12SD-13 64 TCAAAAATCGGAAGGGGGTGGGCTGGAGTTGAGCACGGCCTCTAGGTGAC... RNA cleavage metal ion dependency not reported 
G12SD-21 64 TCGATAGGGGGGTTGGGCAGATTGAAGAGTTATTAAGGTCAGTCAATCGG... RNA cleavage metal ion dependency not reported 
5J-B24 60 TTGAGGTACCAAATATTGTAAATATTGATGGCTGCCGGGCAGACAGTCGG... RNA cleavage metal ion dependency not reported 
625 41 TGTGCTAGGTGTTCTCTGAGCCAGACGTTAGTGTAGTTAAG RNA cleavage Mg2+ 
OA-1 56 GTTGCGGGTCCAGGAAATTATAAAGCCTCTCGGGTTTTTTCGCACGGATT... RNA cleavage Ni2+ Co2+ 
OA-2 57 GTCCCGGTCGCGAGGGCGTCTCTGCAATAAGCTGTGAAGCCGCACGGAGT... RNA cleavage Ni2+ Co2+ 
OA-3 55 ATCCATGATGACGACTCCATTGGAGTCGGGAAGTTGGAAATGCCGAATGC... RNA cleavage Mn2+ 
OA-4 56 GGAACCAAATATTGTAAATATTCATGGCTGGCGGGAGGATGCACGGAGTT... RNA cleavage Mn2+ Ni2+ Co2+ Cd2+ 
OA-5 56 AGAAGTGCACTTTGATTAAGTGCAGCCTGGTGAATAGTTCGCATGGAGTT... RNA cleavage Mn2+ Co2+ 
OA-6 57 GCTAAGGGGGTCAGACGCAAAGTCGAGTTGCATAACTCCAGGCACGGAAT... RNA cleavage Ni2+ Co2+ 
5J-A28 60 TCGAGGAACCAAATATTGTGAATATTGATGCCTGGCGGCAGTCGGTACCG... RNA cleavage Mn2+ Ni2+ Co2+ 
LRD-BT1 52 TGATCGAACTCAACCCGCGTAAGCTCTACAGGAACGGGCAATACGGAAGA... RNA cleavage Mn2+ Co2+ Cd2+ 
5J-A5 60 TCGAGGCACCAAATAATGTAAATATAGATCCCTAGGGGGAGTCGGCCCGC... RNA cleavage metal ion dependency not reported 
5J-A9 60 TCGAGGTACCAATTATTGTGAATAATGATGGCAATAGTCAGTCGGTACAG... RNA cleavage metal ion dependency not reported 
5J-A11 60 TCGAGGTACCAATTATAGTGAATAATGATGGCGATAGTCAGTCGGTACAG... RNA cleavage metal ion dependency not reported 
5J-A14 60 TCGAGGTACCAATAATAGTGGATAATGATGGCAGTAGTCAGTCGGTACAG... RNA cleavage metal ion dependency not reported 
5J-A20 60 TCGAGGCACCAATTATTGTGAATAATGATGGCGATAGACAGTCGGTACAG... RNA cleavage metal ion dependency not reported 
5J-A26 60 TCGAGGTACCAATTATTGTGAATAATGATGGCGATAGTCAGTCGGTACAG... RNA cleavage metal ion dependency not reported 
5J-A30 60 TCGAGGAACCAAATATTGTGAATATTGATGCCTGGCGGCAGTCGGTACCG... RNA cleavage metal ion dependency not reported 
5J-A36 60 TCGAGGTACCAATTATTGTGAATAATGATGGCGATAGCCAGTCGGTACAG... RNA cleavage metal ion dependency not reported 
5J-A39 60 TCGAGGTACCAAATAATGTTAATATTGATCCCTTGGGGGAGTCGGCTCGC... RNA cleavage metal ion dependency not reported 
5J-B12 60 TCGAGGTACCAAATATTGTAAATATTGATGGCTGCCGGGCAGACAGTCGG... RNA cleavage metal ion dependency not reported 
LRD-B 60 AACCCGCGTAAGCTCTACAGGAACGGGCAATACGGAAAAAAGATATGCTA... RNA cleavage metal ion dependency not reported 
LRD-C 60 TTACCATTICATAGATCATATTTCGCAACGATAGGATTCCGAGTCACCGC... RNA cleavage metal ion dependency not reported 
DZ1 79 ATTTCCAGCGGATCGATTCTCTTTCCCGTCGTAGGTATGACCAGGGAAGA... RNA cleavage Mn2+ 
DZ2 80 ACTTCCAGCGGATCGAAATCTTGAACGCAGCTAGGTCTCGGGTGTGGCGG... RNA cleavage Mn2+ 
DZ3 80 ACTGCTAGCAGCTCGAAATCGCTCTCTCAATATGGGCTTTCGGGGAAGAC... RNA cleavage Mn2+ 
DZ4 80 ACCTCAATAGCAGCGTTAACAAAAAGTTTCGAGAAAGCGAATCATCTAAC... RNA cleavage Mn2+ 
DZ5 80 ACTGCCAGCGGCGCGAGGCTCTTGATCGGGCGCAGGAGGGGACCGGTGAT... RNA cleavage Mn2+ 
DZ6 80 ACTGCCAGTGGCGCGAATTCTCTGGGAGATCTGTATAGGGTTGCCTGCGA... RNA cleavage Mn2+ 
DZ7 80 ACTGCCAGCGGCGCGATTCACTGTCGGAGACTAGTTGTTGCCTTCGGCTT... RNA cleavage Mn2+ 
DZ8 79 TACTCTCAGTGAGGCGAAATCTTCTCTCTGCGGGAACAATCGGGGGCGCA... RNA cleavage Mn2+ 
clone11 40 TTGTATTAGCTACACTGTTAGTGCATCGTTTTTAATCTCG RNA cleavage Co2+ 
clone18 40 TTGTATTAGCTACACTGTTAGTGGATCGGGTCTAATCTCG RNA cleavage Co2+ 
9<sub>25</sub>-11 65 GCGTGCCCGTCTGTTGGGCCCTACCAACAGUUCUCAUCCGUAGUGAAGGC... RNA cleavage M2+-independent 
PbE22 (C22) 28 TTTCGCCAGAAGCATAGTGACTCGTGAC RNA cleavage Pb2+ 
C2 27 GAGCATGAAGGCTCCATAAGTCGCGGG RNA cleavage Pb2+ 
C5 32 GAGGAAGGGAAAAACCCACAAAAAAGGATTCC RNA cleavage Pb2+ 
C6 6 TAAGAC RNA cleavage Pb2+ 
C9 30 TAAGCAAAAAGGCTCCACAGGGATGAGGTT RNA cleavage Pb2+ 
C10 31 AAGCCCAGAAGGAAAGGACCATGGATGAGAT RNA cleavage Pb2+ 
C13A 18 AAATCCTAGCGGGAGCGG RNA cleavage Pb2+ 
C13B 31 AAATCCTAGCGGGAGCGGATAGTAGACGTAC RNA cleavage Pb2+ 
C14 31 GGGAACACAGTAAACTGAGGCATAAGGATCC RNA cleavage Pb2+ 
C15 31 CGGACCAGCAGGAAAAATGAACGAATGGAGG RNA cleavage Pb2+ 
C16A 4 AGGA RNA cleavage Pb2+ 
2′:15-2 37 GCGAGAGTGGGGACCGGCCACTCGGAGTGCAGAGAGG RNA cleavage Mg2+ 
15-3 50 GGGACCGGCCACTCGGAGGCATCCATCGTTGCAAACCTTGTTCCCCCTGC RNA cleavage metal ion dependency not reported 
15-7 50 GGGACCGGCCACTCGGAGGCATCCATCGTTGCAGACCTCCTTCCCCCTGC RNA cleavage metal ion dependency not reported 
15-8 50 GGGACCGGCCACTCGGAGGCATCCATCGTTGCAGACCTTCTTCCCCCTGC RNA cleavage metal ion dependency not reported 
15-21 50 GGGACCGGCCACTCGGAGGCATCTATCGTNGCNGACCTTCTTCCCCCTGC RNA cleavage metal ion dependency not reported 
15-23 50 GGGACCGGCTACTCGGAGTGCTTCGTATGTCGGTGAGGGTCTNCCTCCCC RNA cleavage metal ion dependency not reported 
15-26 50 GGGACCGGCCACTCGGAGGCATCNATNGTTGNGGACCTTTTTCCCCCCNC RNA cleavage metal ion dependency not reported 
15-27 50 GGGACCGGCCACTCGGAGGCATCTATCGTTGCAGACCTTCTTCCCCCTGC RNA cleavage metal ion dependency not reported 
L:15-2 48 GGCGATCGTCTCAGACATGNATNNCATCTTGGAGGGNCAGTTCGTCCA RNA cleavage metal ion dependency not reported 
L:15-2 50 GACCGGTCGCCTTAGACTTGCAGAGTCGATGACGCTCGTATCCCACTGGG RNA cleavage metal ion dependency not reported 
L:15-22 50 GCACGATCGTCTTAGACATGCTGAGGTCTTGCTCTCTACAGTTGCCGTCA RNA cleavage metal ion dependency not reported 
L:15-27 50 GCTGATCGTCCCAGACATGCATAGTCCAACTCTCCCTGACACCCTTAGCA RNA cleavage metal ion dependency not reported 
L:15-29 50 GACGATCGTCTCAGACATAAATCCGTTAGTCTCTGTTGTTTTGCGCGCTA RNA cleavage metal ion dependency not reported 
L:15-31 50 GACGAGGGTCTTGGACATAAATCGGACGTCGATGTGACAGCACCAGTCCC RNA cleavage metal ion dependency not reported 
C25B 31 AAGAAAGGCCATAGGAGCCATAGAGGGAATA RNA cleavage Pb2+ 
C27 24 AAGCATGGAAGCAAAGAAGGCACC RNA cleavage Pb2+ 
C28 31 GGAACAGAGCGGGGGAGATAAACAAAGAAAT RNA cleavage Pb2+ 
C30 31 GAGCACTGAAGGACTCCATAACGAGAGGAGG RNA cleavage Pb2+ 
C35 14 ACCGTAGTTCGGAT RNA cleavage Pb2+ 
C36 25 TGAGGAAAGCAAAAAATAAGGATCC RNA cleavage Pb2+ 
C40 29 AATTGACAAATTAAAACAAAGACAGAATG RNA cleavage Pb2+ 
C41 12 ACGGTAAAAGGT RNA cleavage Pb2+ 
C46 5 AGGAG RNA cleavage Pb2+ 
C52 4 ATGA RNA cleavage Pb2+ 
C53 4 AACA RNA cleavage Pb2+ 
C56 3 GGG RNA cleavage Pb2+ 
C57 12 AGAGACGAAGAC RNA cleavage Pb2+ 
RFD‐CD1 40 GATCTGAGTGGATTGGGGCCTGCGCGGAGTCGGGACTATT RNA cleavage TcdC‐24 protein 
RFD-EC1 127 CACGGATCCTGACAAGGATGTGTGCGTTGTCGAGACCTGCGACCGGAACA... RNA cleavage CEM E. coli 
Ce5 55 TTTCGCCATCTTTAGGAATATCTATTCCACGGCTCACGAAATAGTGACTC... RNA cleavage Ce3+ 
Dz20-49 86 GCGTGCCCGTCTGTTGGGCCCTACCAACAAGUCAUGCUCUCUAGUGGUUC... RNA cleavage M2+-independent 
Dz10‐66 82 GCGTGCCCGTCTGTTGGGCCCTACCAACACUAGCAGCGCAAGUGAGGCGC... RNA cleavage M2+-independent 
2′:10-16 41 GCGAGAGTGGTTTAGGGACCGGCACTCGGAGTGCAGAGAGG RNA cleavage Mg2+ 
L:15-30 29 GCCTCCTCATCGTCTTAGACAGCCTCTCC RNA cleavage Mn2+ 
LRD-A 60 CGAACGAAAAGTAACAGGCCCTCCTCATTACCATCCATGGAAGCATAGTT... RNA cleavage metal ion dependency not reported 
6-61 40 TCCAAAGATCGAGGTAGGGGTTCCGAACCAGGTGGCGTGC RNA cleavage metal ion dependency not reported 
6-63 40 GCTCTTAGGAGGTAGGGGTTCCGATCCAGGTGGCTGGGTA RNA cleavage metal ion dependency not reported 
6-67 42 TCTCGGGCGGCGGAGGAGGTAGGGGTTCCGCTCCACAAGGGC RNA cleavage metal ion dependency not reported 
12-29 40 TCTCTTTCTGCAGAGGAGGTAGGGGTTCCGCTCCAAGGGC RNA cleavage metal ion dependency not reported 
12-6 39 GGCAGCGAATAGAGGAGGTAGGGGTTCCGCTCCAAGGGC RNA cleavage metal ion dependency not reported 
12-8 39 GTGCTTGCGACGAGGTAGGGGTTCCGATCCAATGGGCTG RNA cleavage metal ion dependency not reported 
pH3DZ1 69 AGTTGGCGAAGATCGGTAGTACGAGGAAATAGGGGGTGAGTGGTGTAGGC... RNA cleavage M2+-independent 

Reactions

Name Description
RNA cleavage

The first described RNA cleaving DNAzyme was able to cleave a DNA oligonucleotide at a position in the sequence where a single ribonucleotide was embedded. RNA cleaving DNAzymes are one of the most pursued kinds of DNA catalysts, in part due to their practical and analytical applications, nowadays being able to cleave an all-RNA substrate practically at any desired position. The cleavage reaction, that proceeds in the presence of divalent metal ions, forms a 5’ product bearing a 2’3’-cyclic phosphate terminus and a 3’ product bearing a 5’-OH terminus. Diverse ribonuclease protein enzymes, for instance, RNAse A, as well as ribozymes, such as the hammerhead, yield the same reaction products.


RNA ligation

RNA-ligating DNAzymes can give different reaction products: linear RNA (native and non-native linkages), branched RNA (branched or lariat if the two substrates are connected), as well as some unnatural linkages. These DNAzymes are useful for the preparation of long RNAs for structural and functional studies. Different combinations of activated RNA substrates together with the appropriate DNAzyme can be used to achieve the desired ligated product.

DNAzymes for the formation of RNA linear linkages

For the formation of RNA native linkages, it is possible to join a 2’,3’-cyclic phosphate with a 5’-OH, or else, a 2’,3’-diol with a 5’-triphosphate. Using a 3’-OH group and a 5’-triphosphate, proteinaceous RNA polymerases, assisted by divalent cations, as well as the class I ligase and the L1 ligase ribozymes, catalyze the formation of a native RNA phosphodiester linkage.



DNAzymes for the formation of branched and lariat products

The preparation of branched or lariat RNAs, most commonly can be achieved when a 5'-triphosphorylated ribonucleotide attacks a 2’-OH group at the branching site. Natural 2',5'-branched RNA products are formed during pre-mRNA processing by the spliceosome.



Articles

Year of pub. First Author, Last Author Title
2005 Y Wang, S K Silverman Efficient one-step synthesis of biologically related lariat RNAs by a deoxyribozyme.
2003 Y Wang, S K Silverman Characterization of deoxyribozymes that synthesize branched RNA.
2004 D J-F Chinnapen, D Sen A deoxyribozyme that harnesses light to repair thymine dimers in DNA.
2010 F Wachowius, C Höbartner Combinatorial mutation interference analysis reveals functional nucleotides required for DNA catalysis.
1994 R R Breaker, G F Joyce A DNA enzyme that cleaves RNA.
2020 K Le Vay, H Mutschler Nucleic Acid Catalysis under Potential Prebiotic Conditions.
1997 S W Santoro, G F Joyce A general purpose RNA-cleaving DNA enzyme.
1997 C R Geyer, D Sen Evidence for the metal-cofactor independence of an RNA phosphodiester-cleaving DNA enzyme.
2008 P I Pradeepkumar, Scott K Silverman DNA-catalyzed formation of nucleopeptide linkages.
1999 Y Li, R R Breaker Deoxyribozymes: new players in the ancient game of biocatalysis.
1997 R R Breaker DNA enzymes
2009 S K Silverman Deoxyribozymes: Selection Design and Serendipity in the Development of DNA Catalysts†
2016 S K Silverman Catalytic DNA: Scope, Applications, and Biochemistry of Deoxyribozymes
2019 L M Khachigian Deoxyribozymes as Catalytic NanotherapeuticAgents
2019 M Hollenstein Nucleic acid enzymes based on functionalized nucleosides
1997 R R Breaker DNA aptamers and DNA enzymes
2008 D M Kost, S K Silverman Controlling the direction of site-selectivity and regioselectivity in RNA ligation by Zn2+-dependent deoxyribozymes that use 2',3'-cyclic phosphate RNA substrates.
2001 M Sioud Nucleic Acid Enzymes as a Novel Generation of Anti-gene Agents
2015 M Hollenstein DNA Catalysis: The Chemical Repertoire of DNAzymes
2005 S K Silverman In vitro selection, characterization, and application of deoxyribozymes that cleave RNA
2008 S K Silverman Catalytic DNA (deoxyribozymes) for synthetic applications—current abilities and future prospects
2000 A Peracchi Preferential Activation of the 8–17 Deoxyribozyme by Ca2+ Ions EVIDENCE FOR THE IDENTITY OF 8–17 WITH THE CATALYTIC DOMAIN OF THE MG5 DEOXYRIBOZYME
1996 D Faulhammer, M Famulok The Ca2+ Ion as a Cofactor for a Novel RNA‐Cleaving Deoxyribozyme
2005 Y Wang, S K Silverman Directing the outcome of deoxyribozyme selections to favor native 3'-5' RNA ligation.
2006 N Paul, G F Joyce Conversion of a ribozyme to a deoxyribozyme through in vitro evolution.
2003 Y Wang, S K Silverman Deoxyribozymes that synthesize branched and lariat RNA.
2004 T K Prior, S K Silverman Structure-function correlations derived from faster variants of a RNA ligase deoxyribozyme.
2004 R L Coppins, S K Silverman A DNA enzyme that mimics the first step of RNA splicing.
2011 F Wachowius, C Höbartner Probing essential nucleobase functional groups in aptamers and deoxyribozymes by nucleotide analogue interference mapping of DNA.
2005 W E Purtha, S K Silverman General deoxyribozyme-catalyzed synthesis of native 3'-5' RNA linkages.
2005 K A Hoadley, S K Silverman Zn2+-dependent deoxyribozymes that form natural and unnatural RNA linkages.
2007 C Höbartner, S K Silverman Engineering a selective small-molecule substrate binding site into a deoxyribozyme.
2005 R L Coppins, S K Silverman Mimicking the first step of RNA splicing: an artificial DNA enzyme can synthesize branched RNA using an oligonucleotide leaving group as a 5'-exon analogue.
2005 R L Coppins, S K Silverman A deoxyribozyme that forms a three-helix-junction complex with its RNA substrates and has general RNA branch-forming activity.
2004 R L Coppins, S K Silverman Rational modification of a selection strategy leads to deoxyribozymes that create native 3'-5' RNA linkages.
2006 E Zelin, Scott K Silverman Adenosine is inherently favored as the branch-site RNA nucleotide in a structural context that resembles natural RNA splicing.
2005 D R Semlow, S K Silverman Parallel selections in vitro reveal a preference for 2'-5' RNA ligation upon deoxyribozyme-mediated opening of a 2',3'-cyclic phosphate.
2018 A Barlev, D Sen DNA's Encounter with Ultraviolet Light: An Instinct for Self-Preservation?
1995 R R Breaker, G F Joyce A DNA enzyme with Mg(2+)-dependent RNA phosphoesterase activity.
1997 D Faulhammer, M Famulok Characterization and divalent metal-ion dependence of in vitro selected deoxyribozymes which cleave DNA/RNA chimeric oligonucleotides.
1998 A Roth, R R Breaker An amino acid as a cofactor for a catalytic polynucleotide.
2009 K Schlosser, Y Li Biologically inspired synthetic enzymes made from DNA.
2009 S K Silverman, D A Baum Use of deoxyribozymes in RNA research.
2020 S Safdar, D Spasic RNA-Cleaving NAzymes: The Next Big Thing in Biosensing?
2020 M Cepeda-Plaza, A Peracchi Insights into DNA catalysis from structural and functional studies of the 8-17 DNAzyme.
2020 L Ma, J Liu Catalytic Nucleic Acids: Biochemistry, Chemical Biology, Biosensors, and Nanotechnology.
2020 F Javadi-Zarnaghi, C Höbartner Strategies for Characterization of Enzymatic Nucleic Acids.
2018 W Zhou, J Liu Multi-metal-dependent nucleic acid enzymes.
2008 M Hollenstein, D M Perrin A Highly Selective DNAzyme Sensor for Mercuric Ions
2017 W Zhou, J Liu Theranostic DNAzymes.
2000 J Nowakowski, G F Joyce Alternative conformations of a nucleic acid four-way junction.
1995 B Cuenoud, J W Szostak A DNA metalloenzyme with DNA ligase activity.
2012 T E Velez, S K Silverman Systematic evaluation of the dependence of deoxyribozyme catalysis on random region length.
2018 M V Sednev, C Höbartner N -Methyladenosine-Sensitive RNA-Cleaving Deoxyribozymes.
2003 A Flynn-Charlebois, S K Silverman In vitro evolution of an RNA-cleaving DNA enzyme into an RNA ligase switches the selectivity from 3'-5' to 2'-5'.
2019 J Aranda, M Orozco An artificial DNAzyme RNA ligase shows a reaction mechanism resembling that of cellular polymerases
1997 Y Li, D Sen Toward an efficient DNAzyme.
2005 E D Pratico, S K Silverman A deoxyribozyme that synthesizes 2',5'-branched RNA with any branch-site nucleotide.
2017 A A Fokina, D A Stetsenko Delivery of therapeutic RNA-cleaving oligodeoxyribonucleotides (deoxyribozymes): from cell culture studies to clinical trials.
1999 J Nowakowski, G F Joyce Crystal structure of an 82-nucleotide RNA–DNA complex formed by the 10-23 DNA enzyme
2018 D Morrison, M Rothenbroker, DNAzymes: Selected for Applications
2017 H Liu, J Gan Crystal structure of an RNA-cleaving DNAzyme.
2003 B L Ricca, S K Silverman Optimization and generality of a small deoxyribozyme that ligates RNA.
2003 A Flynn-Charlebois, S K Silverman Deoxyribozymes with 2'-5' RNA ligase activity.
2016 A Ponce-Salvatierra, V Pena Crystal structure of a DNA catalyst.
2000 J Li, Y Lu In vitro selection and characterization of a highly efficient Zn(II)-dependent RNA-cleaving deoxyribozyme.
2011 O Y Wong, S K Silverman DNA-catalyzed covalent modification of amino acid side chains in tethered and free peptide substrates.
2016 R Saran, J Liu A Silver DNAzyme.
2020 D Balke, S Müller Challenges and Perspectives in Nucleic Acid Enzyme Engineering.
2017 J Palou-Mir, R K O Sigel The Role of Lead(II) in Nucleic Acids.
2013 S M Walsh, S K Silverman DNA catalysts with tyrosine kinase activity.
2011 C S Lee, S K Silverman Improved deoxyribozymes for synthesis of covalently branched DNA and RNA.
2009 G S Sekhon, D Sen Unusual DNA-DNA cross-links between a photolyase deoxyribozyme, UV1C, and its bound oligonucleotide substrate.
2011 M Hollenstein Expanding the catalytic repertoire of DNAzymes by modified nucleosides
2000 T L Sheppard, G F Joyce A DNA enzyme with N-glycosylase activity.
2014 C Chu, S K Silverman A generalizable DNA-catalyzed approach to peptide-nucleic acid conjugation.
2012 A Sachdeva, S K Silverman Covalent tagging of phosphorylated peptides by phosphate-specific deoxyribozymes.
2016 A J Camden, S K Silverman DNA Oligonucleotide 3'-Phosphorylation by a DNA Enzyme.
2012 A Sachdeva, S K Silverman DNA-catalyzed reactivity of a phosphoramidate functional group and formation of an unusual pyrophosphoramidate linkage.
2008 M Chandra, S K Silverman DNA and RNA can be equally efficient catalysts for carbon-carbon bond formation.
2013 D J Parker, S K Silverman DNA catalysis of a normally disfavored RNA hydrolysis reaction.
2016 C Chu, S K Silverman Assessing histidine tags for recruiting deoxyribozymes to catalyze peptide and protein modification reactions.
2016 A Kasprowicz, J Ciesiołka Characterization of Highly Efficient RNA‐Cleaving DNAzymes that Function at Acidic pH with No Divalent Metal‐Ion Cofactors
2019 D Peng, J Liu Efficient DNA-Catalyzed Porphyrin Metalation for Fluorescent Ratiometric Pb Detection.
2020 A Liaqat, C Höbartner N 6-isopentenyladenosine in RNA determines the cleavage site of endonuclease deoxyribozymes.
2009 M Chandra, S K Silverman DNA-catalyzed sequence-specific hydrolysis of DNA
2013 A K Behera, A Baum Enhanced deoxyribozyme‐catalyzed RNA ligation in the presence of organic cosolvents
2013 F Javadi-Zarnaghi Lanthanide cofactors accelerate DNA-catalyzed synthesis of branched RNA.
2003 Z Liu, Y Li Assemblage of signaling DNA enzymes with intriguing metal-ion specificities and pH dependences.
2012 T Lan, Y Lu Metal ion-dependent DNAzymes and their applications as biosensors.
2010 K Schlosser, Y Li A versatile endoribonuclease mimic made of DNA: characteristics and applications of the 8-17 RNA-cleaving DNAzyme.
2009 K Schlosser, Y Li DNAzyme-mediated catalysis with only guanosine and cytidine nucleotides.
2003 M J Cairns, L‐Q Sun Optimisation of the 10-23 DNAzyme-substrate pairing interactions enhanced RNA cleavage activity at purine-cytosine target sites.
2005 A Peracchi, M Clerici A mutational analysis of the 8-17 deoxyribozyme core.
2008 K Schlosser, Y Li Sequence-function relationships provide new insight into the cleavage site selectivity of the 8–17 RNA-cleaving deoxyribozyme
2004 R P.G Cruz, Y Li Dinucleotide Junction Cleavage Versatility of 8-17 Deoxyribozyme
2008 K Schlosser, J Gu, L Sule Sequence-function relationships provide new insight into the cleavage site selectivity of the 8-17 RNA-cleaving deoxyribozyme
2019 E J Mattioli, M Calvaresi DNAzymes at Work: A DFT Computational Investigation on the Mechanism of 9DB1
2017 R Saran, J Liu A Silver-Specific DNAzyme with a New Silver Aptamer and Salt-Promoted Activity.
2005 K E Nelson, Y Lu In vitro selection of high temperature Zn(2+)-dependent DNAzymes.
2014 P-J J Huang, J Liu In vitro selection of a new lanthanide-dependent DNAzyme for ratiometric sensing lanthanides.
2016 W Zhou, J Liu A DNAzyme requiring two different metal ions at two distinct sites.
2011 M M Ali, Y Li Fluorogenic DNAzyme probes as bacterial indicators.
2002 L Lermer, D M Perrin Toward an RNaseA mimic: A DNAzyme with imidazoles and cationic amines.
2010 J C F Lam, Y Li A complex RNA-cleaving DNAzyme that can efficiently cleave a pyrimidine-pyrimidine junction.
2009 M Hollenstein, D M Perrin A DNAzyme with three protein-like functional groups: enhancing catalytic efficiency of M2+-independent RNA cleavage.
2015 S-F Torabi, Y Lu In vitro selection of a sodium-specific DNAzyme and its application in intracellular sensing
2019 L Ma, J Liu From general base to general acid catalysis in a sodium-specific DNAzyme by a guanine-to-adenine mutation
2019 L Ma, J Liu An in Vitro-Selected DNAzyme Mutant Highly Specific for Na under Slightly Acidic Conditions.
2015 S-F Torabi, Y Lu Identification of the Same Na(+)-Specific DNAzyme Motif from Two In Vitro Selections Under Different Conditions.
2003 S H J Mei, Y Li An efficient RNA-cleaving DNA enzyme that synchronizes catalysis with fluorescence signaling.
2011 C J Hipolito, D M Perrin Protein-inspired modified DNAzymes: dramatic effects of shortening side-chain length of 8-imidazolyl modified deoxyadenosines in selecting RNaseA mimicking DNAzymes.
2016 W Zhou, J Liu An Efficient Lanthanide-Dependent DNAzyme Cleaving 2'-5'-Linked RNA.
2015 R Saran, J Liu Searching for a DNAzyme Version of the Leadzyme.
2019 Y Wang, H Yu A Novel Small RNA-Cleaving Deoxyribozyme with a Short Binding Arm
2013 M Hollenstein, D M Perrin Toward the combinatorial selection of chemically modified DNAzyme RNase A mimics active against all-RNA substrates.
2001 D M Perrin, C Hélène Bridging the gap between proteins and nucleic acids: a metal-independent RNAseA mimic with two protein-like functionalities.
2020 C P M Scheitl, C Höbartner New Deoxyribozymes for the Native Ligation of RNA.
1999 Y Li, R R Breaker Phosphorylating DNA with DNA.
2018 L Gu, J Liu Reselection Yielding a Smaller and More Active Silver-Specific DNAzyme.
2016 P-J J Huang, J Liu Distinction of Individual Lanthanide Ions with a DNAzyme Beacon Array
2016 W Zhou, J Liu In Vitro Selection of Chromium-Dependent DNAzymes for Sensing Chromium(III) and Chromium(VI).
2019 P-J J Huang, J Liu Instantaneous Iodine-Assisted DNAzyme Cleavage of Phosphorothioate RNA.
2015 M Vazin, J Liu Biochemical Characterization of a Lanthanide-Dependent DNAzyme with Normal and Phosphorothioate-Modified Substrates.
2015 P-J J Huang, J Liu A new heavy lanthanide-dependent DNAzyme displaying strong metal cooperativity and unrescuable phosphorothioate effect.
2015 P-J J Huang, J Liu Desulfurization Activated Phosphorothioate DNAzyme for the Detection of Thallium.
2016 P-J J Huang, J Liu In Vitro Selection of a DNAzyme Cooperatively Binding Two Lanthanide Ions for RNA Cleavage.
2015 W Zhou, J Liu A New Na+‐Dependent RNA‐Cleaving DNAzyme with over 1000‐fold Rate Acceleration by Ethanol
2017 W Zhou, J Liu An Exceptionally Selective DNA Cooperatively Binding Two Ca Ions.
2018 T Yu, J Liu An RNA-Cleaving Catalytic DNA Accelerated by Freezing.
2016 P-J J Huang, J Liu An Ultrasensitive Light-up Cu(2+) Biosensor Using a New DNAzyme Cleaving a Phosphorothioate-Modified Substrate.
2015 P-J J Huang, J Liu Rational evolution of Cd2+-specific DNAzymes with phosphorothioate modified cleavage junction and Cd2+ sensing.
2020 W Ren, J Liu Selection of a metal ligand modified DNAzyme for detecting Ni.
2015 Rachel Gysbers, Y Li Evolution of an Enzyme from a Noncatalytic Nucleic Acid Sequence.
2000 S W Santoro, C F Barbas RNA Cleavage by a DNA Enzyme with Extended Chemical Functionality
2018 Y Wang, D M Perrin A densely modified M2+-independent DNAzyme that cleaves RNA efficiently with multiple catalytic turnover
2020 P-J J Huang, J Liu Target Self-Enhanced Selectivity in Metal-Specific DNAzymes.
2007 W Chiuman, Y Li Simple fluorescent sensors engineered with catalytic DNA 'MgZ' based on a non-classic allosteric design.
2004 M A Carrigan, S A Benner Quantitative analysis of a RNA-cleaving DNA catalyst obtained via in vitro selection.
2006 W Chiuman, Y Li Revitalization of six abandoned catalytic DNA species reveals a common three-way junction framework and diverse catalytic cores.
2015 K Tram, Y Li An Efficient Catalytic DNA that Cleaves L-RNA.
2002 P Ordoukhanian, G F Joyce RNA-cleaving DNA enzymes with altered regio- or enantioselectivity.
2004 K Schlosser, Y Li Tracing sequence diversity change of RNA-cleaving deoxyribozymes under increasing selection pressure during in vitro selection.
2006 K Schlosser, Y Li Characterization of long RNA-cleaving deoxyribozymes with short catalytic cores: the effect of excess sequence elements on the outcome of in vitro selection.
2002 P J Bruesehoff, Y Lu Improving metal ion specificity during in vitro selection of catalytic DNA.
2008 K Schlosser, Y Li In vitro selection of small RNA-cleaving deoxyribozymes that cleave pyrimidine-pyrimidine junctions.
2001 A R Feldman, D Sen A new and efficient DNA enzyme for the sequence-specific cleavage of RNA.
2004 A V Sidorov, D M Williams Sequence-specific cleavage of RNA in the absence of divalent metal ions by a DNAzyme incorporating imidazolyl and amino functionalities.
2008 T P Mui, S K Silverman Convergent and general one-step DNA-catalyzed synthesis of multiply branched DNA.
2007 J Liu, Y Lu A catalytic beacon sensor for uranium with parts-per-trillion sensitivity and millionfold selectivity.
2009 A K Brown, Y Lu Biochemical characterization of a uranyl ion-specific DNAzyme.
2013 P Wu, Y Lu A DNAzyme-gold nanoparticle probe for uranyl ion in living cells.
2009 M Hollenstein, D M Perrin A self-cleaving DNA enzyme modified with amines, guanidines and imidazoles operates independently of divalent metal cations (M2+).
2014 P-J J Huang, J Liu Ultrasensitive DNAzyme beacon for lanthanides and metal speciation.
2017 W Zhou, J Liu Two Completely Different Mechanisms for Highly Specific Na+ Recognition by DNAzymes
2000 J Li, Y Lu A Highly Sensitive and Selective Catalytic DNA Biosensor for Lead Ions
2006 W Chiuman, Y Li Evolution of high-branching deoxyribozymes from a catalytic DNA with a three-way junction.
2012 K E Nelson, Y Lu The importance of peripheral sequences in determining the metal selectivity of an in vitro-selected Co(2+) -dependent DNAzyme.
2016 Z Shen, Y Li A Catalytic DNA Activated by a Specific Strain of Bacterial Pathogen.

Structures

Structure Accession number
5CKI
5CKK
5XMA
5XM9
5XM8
1BR3
1EGK
Copyright © Genesilico - All rights reserved
This website is free, open to all users and there is no login required.
If you have any advice or suggestions for corrections or improvements, please contact: Almudena Ponce Salvatierra